• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Zea Mays


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGTGACCCTTAAACAAAACAGACCGCNAACGCGACTCTCATGCCGCCGGGCCTCGGCTCGGCANGCNGCCCCCGAGCCCTGTCATGGGGCGGAGGGGCCACAAAAGAACCCACGGCGCCTAAGGCGTCAAGGAACACTTATATTGACTTGGCACGGCGGAGCGGTCGGCTTGCCTTCCGCTCCCAGGGCAGCGATGATATCTTAATCCACACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCAAAATGCGATACCTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCGGAGGGCACGTCTGCCTGGGCGTCACGCCAAAAGACACTCCCAACACCCCCCCGCGGGCGGAGGGACGTGGCGTCTGGCCCCCCGTGCCTCACGGCGCGGTGGGCCGAAGTTGGGGCTGCCGGCGAATCGTGTCGGGCACAGCACGTGGTGGGCGACACCTAGTTGTTCTCGGTGCAGCGCCCCGGCACGCGGCCGGCGCATCGGCCCTAAGGACCCATGGAGCACCGCAGCGCACCGCCGCTCGGACCGCGACCCCAGGTCAGTCGGGACT

Click for details-----ITS1

CCGTGACCCTTAAACAAAACAGACCGCGAACGAGTCACCCGTGCCGCCGGGCTCCGGCCCGGCACGCTGCCCCCCCCCCCGAACCTCCCGCGGGGAAGGGGGGGCCGCGAAAAAGAACCCACGGCGCCCCGGGCGCCAAGGAACACCAGTACTACCTCCTGCCCCGCGGAGCGGTCGGCCCGCCTTCCGCTCCCCGGGCAGCGGCTACACCTTAATCGACA

Click for details-----ITS2

ATCGCTGCCCCCACATACAACACCCACTTAGGTTTGTTGCATTGGCGGGGGTACATGTTGGCCTCCCGTGTGCACCGTCGCACGGATGGCTTAAAATTGAGTCCTCGGCATCTGTTGTCGTGACACTACGGTGGTTGATTCAACCTCGGTACCGTGTCTTGATCTCAGCTTGCNTGCCTCCTCTTTGTGAGTGAGGGAGGGATCTTATGTTGACCCTTTGAACATTGTCCCCAAAGACGATGCTCTCGACGCGACCCCAGGTCAGGCG
Taxonomic Information

Plant ID: NPO15810
Plant Latin Name: Zea Mays
Taxonomy Genus: Zea
Taxonomy Family: Poaceae

Plant External Links:

NCBI TaxonomyDB: 4577
Plant-of-the-World-Online: 426810-1

Used in Medicines

Country/Region:
Turkey; Canada; Madagascar; Italy; Turkmenistan; Lebanon; Syrian Arab Republic; Swaziland; Argentina; Burkina Faso; Ghana; Israel; Togo; Zimbabwe; Jordan; Chile; Thailand; Iraq; Nigeria; Philippines; Indonesia; United States; Russia; Brazil; Romania; Angola; Portugal; Mexico; South Africa; India; China; Kenya; South Korea

Traditional Medicine System:
Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Cancer; Cholagogue; Demulcent; Diuretic; Hypoglycaemic; Hypotensive; Lithontripic; Stimulant; Vasodilator; Warts

Geographical Distribution

Canada; Turkmenistan; Cambodia; Ethiopia; Swaziland; Argentina; Bolivia; Cameroon; Burkina Faso; Ghana; Guatemala; Germany; Spain; Netherlands; Jamaica; Oman; Tanzania; Seychelles; French Guiana; Yemen; Pakistan; Albania; India; Kenya; South Korea; Tajikistan; Turkey; Afghanistan; Bangladesh; Cyprus; France; Syrian Arab Republic; Rwanda; Somalia; Peru; Laos; Vanuatu; Cote d'Ivoire; Benin; Cuba; Togo; China; Dominican Republic; Ukraine; Indonesia; Mauritius; Belarus; Mali; Russia; Bulgaria; United States; Romania; Angola; Portugal; South Africa; Nicaragua; Austria; Vietnam; Mozambique; Japan; Niger; Brazil; Guinea; Costa Rica; Bahamas; Ireland; Nigeria; Ecuador; Australia; Algeria; Chile; Belgium; Thailand; Haiti; Belize; Sierra Leone; Georgia; Gambia; Poland; Morocco; Guinea-Bissau; Switzerland; Iraq; Chad; Uruguay; Mexico; Lebanon; Uzbekistan; Tunisia; Djibouti; Colombia; Burundi; Fiji; Madagascar; Italy; Sudan; Nepal; Israel; Zambia; Papua New Guinea; Zimbabwe; Jordan; Kazakhstan; Philippines; New Caledonia; Trinidad and Tobago; Hungary; Honduras; Myanmar; Equatorial Guinea; Egypt; United Kingdom; Greece; Sri Lanka; Comoros

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

306 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


238 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

169 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC98098

Ingredient ID: NPC96102

Ingredient ID: NPC95969

Ingredient ID: NPC9424

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC93843

Ingredient ID: NPC88846

Ingredient ID: NPC88278

Ingredient ID: NPC87880

Ingredient ID: NPC85813

Ingredient ID: NPC82460

Ingredient ID: NPC81989

Ingredient ID: NPC81015

Ingredient ID: NPC81010

Ingredient ID: NPC80090

Ingredient ID: NPC78551

Ingredient ID: NPC78500

Ingredient ID: NPC75584

Ingredient ID: NPC75204

Ingredient ID: NPC75121

Ingredient ID: NPC72324

Ingredient ID: NPC72024

Ingredient ID: NPC71703

Ingredient ID: NPC70744

Ingredient ID: NPC69445

Ingredient ID: NPC69260

Ingredient ID: NPC68425

Ingredient ID: NPC67920

Ingredient ID: NPC66624

Ingredient ID: NPC66352

Ingredient ID: NPC65314

Ingredient ID: NPC64292

Ingredient ID: NPC62765

Ingredient ID: NPC62045

Ingredient ID: NPC61473

Ingredient ID: NPC60942

Ingredient ID: NPC60361

Ingredient ID: NPC59650

Ingredient ID: NPC59581

Ingredient ID: NPC57719

Ingredient ID: NPC57279

Ingredient ID: NPC55412

Ingredient ID: NPC54264

Ingredient ID: NPC5413

Ingredient ID: NPC52472

Ingredient ID: NPC52403

Ingredient ID: NPC49151

Ingredient ID: NPC490504

Ingredient ID: NPC490461

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490333

Ingredient ID: NPC490261

Ingredient ID: NPC490260

Ingredient ID: NPC490241

Ingredient ID: NPC490240

Ingredient ID: NPC490239

Ingredient ID: NPC490238

Ingredient ID: NPC490081

Ingredient ID: NPC490058

Ingredient ID: NPC489981

Ingredient ID: NPC489928

Ingredient ID: NPC489913

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC489899

Ingredient ID: NPC489877

Ingredient ID: NPC486677

Ingredient ID: NPC486676

Ingredient ID: NPC486675

Ingredient ID: NPC486674

Ingredient ID: NPC486673

Ingredient ID: NPC486672

Ingredient ID: NPC486671

Ingredient ID: NPC486670

Ingredient ID: NPC486669

Ingredient ID: NPC486668

Ingredient ID: NPC486667

Ingredient ID: NPC486666

Ingredient ID: NPC486665

Ingredient ID: NPC48623

Ingredient ID: NPC482298

Ingredient ID: NPC45782

Ingredient ID: NPC45540

Ingredient ID: NPC44751

Ingredient ID: NPC424

Ingredient ID: NPC41675

Ingredient ID: NPC41667

Ingredient ID: NPC4147

Ingredient ID: NPC40249

Ingredient ID: NPC39426

Ingredient ID: NPC35909

Ingredient ID: NPC34877

Ingredient ID: NPC34764

Ingredient ID: NPC34440

Ingredient ID: NPC329148

Ingredient ID: NPC328788

Ingredient ID: NPC328447

Ingredient ID: NPC326686

Ingredient ID: NPC326445

Ingredient ID: NPC323099

Ingredient ID: NPC32279

Ingredient ID: NPC320779

Ingredient ID: NPC317758

Ingredient ID: NPC317120

Ingredient ID: NPC314184

Ingredient ID: NPC313059

Ingredient ID: NPC312132

Ingredient ID: NPC31152

Ingredient ID: NPC309318

Ingredient ID: NPC307963

Ingredient ID: NPC30774

Ingredient ID: NPC304927

Ingredient ID: NPC30430

Ingredient ID: NPC301696

Ingredient ID: NPC300623

Ingredient ID: NPC29883

Ingredient ID: NPC297422

Ingredient ID: NPC296337

Ingredient ID: NPC295777

Ingredient ID: NPC295644

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC294185

Ingredient ID: NPC294134

Ingredient ID: NPC291066

Ingredient ID: NPC29091

Ingredient ID: NPC289974

Ingredient ID: NPC289388

Ingredient ID: NPC289120

Ingredient ID: NPC288903

Ingredient ID: NPC287890

Ingredient ID: NPC287660

Ingredient ID: NPC28657

Ingredient ID: NPC285322

Ingredient ID: NPC283682

Ingredient ID: NPC282370

Ingredient ID: NPC281686

Ingredient ID: NPC280965

Ingredient ID: NPC279895

Ingredient ID: NPC279865

Ingredient ID: NPC279300

Ingredient ID: NPC279026

Ingredient ID: NPC2785

Ingredient ID: NPC278430

Ingredient ID: NPC278010

Ingredient ID: NPC277073

Ingredient ID: NPC277

Ingredient ID: NPC275856

Ingredient ID: NPC275462

Ingredient ID: NPC275370

Ingredient ID: NPC275287

Ingredient ID: NPC272614

Ingredient ID: NPC271607

Ingredient ID: NPC270334

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC269206

Ingredient ID: NPC267296

Ingredient ID: NPC266040

Ingredient ID: NPC2660

Ingredient ID: NPC265319

Ingredient ID: NPC265305

Ingredient ID: NPC265146

Ingredient ID: NPC26326

Ingredient ID: NPC261831

Ingredient ID: NPC260363

Ingredient ID: NPC259512

Ingredient ID: NPC257763

Ingredient ID: NPC257182

Ingredient ID: NPC257124

Ingredient ID: NPC256300

Ingredient ID: NPC256035

Ingredient ID: NPC255221

Ingredient ID: NPC251666

Ingredient ID: NPC248758

Ingredient ID: NPC24824

Ingredient ID: NPC246679

Ingredient ID: NPC246558

Ingredient ID: NPC246358

Ingredient ID: NPC246165

Ingredient ID: NPC242580

Ingredient ID: NPC240206

Ingredient ID: NPC239037

Ingredient ID: NPC23801

Ingredient ID: NPC237812

Ingredient ID: NPC236602

Ingredient ID: NPC232311

Ingredient ID: NPC231331

Ingredient ID: NPC231324

Ingredient ID: NPC230301

Ingredient ID: NPC230085

Ingredient ID: NPC228974

Ingredient ID: NPC227570

Ingredient ID: NPC226453

Ingredient ID: NPC226340

Ingredient ID: NPC225783

Ingredient ID: NPC223737

Ingredient ID: NPC222997

Ingredient ID: NPC22229

Ingredient ID: NPC220408

Ingredient ID: NPC219246

Ingredient ID: NPC216077

Ingredient ID: NPC214502

Ingredient ID: NPC214367

Ingredient ID: NPC210987

Ingredient ID: NPC210560

Ingredient ID: NPC209111

Ingredient ID: NPC208793

Ingredient ID: NPC208668

Ingredient ID: NPC208075

Ingredient ID: NPC207554

Ingredient ID: NPC206500

Ingredient ID: NPC204838

Ingredient ID: NPC204104

Ingredient ID: NPC203912

Ingredient ID: NPC203719

Ingredient ID: NPC203468

Ingredient ID: NPC201844

Ingredient ID: NPC201284

Ingredient ID: NPC199072

Ingredient ID: NPC198680

Ingredient ID: NPC197356

Ingredient ID: NPC196776

Ingredient ID: NPC194944

Ingredient ID: NPC19319

Ingredient ID: NPC193062

Ingredient ID: NPC190301

Ingredient ID: NPC189436

Ingredient ID: NPC188428

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC180199

Ingredient ID: NPC178394

Ingredient ID: NPC17810

Ingredient ID: NPC17779

Ingredient ID: NPC176017

Ingredient ID: NPC175913

Ingredient ID: NPC175342

Ingredient ID: NPC1748

Ingredient ID: NPC174304

Ingredient ID: NPC174246

Ingredient ID: NPC173996

Ingredient ID: NPC171188

Ingredient ID: NPC168508

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC166031

Ingredient ID: NPC165651

Ingredient ID: NPC164646

Ingredient ID: NPC164487

Ingredient ID: NPC163556

Ingredient ID: NPC160842

Ingredient ID: NPC155263

Ingredient ID: NPC154466

Ingredient ID: NPC153556

Ingredient ID: NPC152964

Ingredient ID: NPC152451

Ingredient ID: NPC151593

Ingredient ID: NPC151422

Ingredient ID: NPC1513

Ingredient ID: NPC150950

Ingredient ID: NPC148951

Ingredient ID: NPC147983

Ingredient ID: NPC146245

Ingredient ID: NPC14552

Ingredient ID: NPC143979

Ingredient ID: NPC141953

Ingredient ID: NPC14002

Ingredient ID: NPC13991

Ingredient ID: NPC139658

Ingredient ID: NPC137958

Ingredient ID: NPC136014

Ingredient ID: NPC135692

Ingredient ID: NPC135238

Ingredient ID: NPC134616

Ingredient ID: NPC134114

Ingredient ID: NPC131981

Ingredient ID: NPC130683

Ingredient ID: NPC129652

Ingredient ID: NPC128825

Ingredient ID: NPC126681

Ingredient ID: NPC125062

Ingredient ID: NPC124323

Ingredient ID: NPC123229

Ingredient ID: NPC122212

Ingredient ID: NPC120649

Ingredient ID: NPC115723

Ingredient ID: NPC114992

Ingredient ID: NPC11433

Ingredient ID: NPC114239

Ingredient ID: NPC112945

Ingredient ID: NPC112890

Ingredient ID: NPC112439

Ingredient ID: NPC111888

Ingredient ID: NPC111710

Ingredient ID: NPC110899

Ingredient ID: NPC110008

Ingredient ID: NPC107387

Ingredient ID: NPC106076

Ingredient ID: NPC104195

Ingredient ID: NPC103213

Ingredient ID: NPC102091

Ingredient ID: NPC100879