• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Anthriscus Sylvestris


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCTCAAGCGGAATGACCCGTTAACTCGTTAAAACATCGGGCAAGCGTTAGGGGGCCCAAGGTCCCCTCTTTGCGATCCCGTGGTGGTTGTCCCCTCACGGGTGTCAACCAACCAAATAAATCAACCGGGCGCTGACGGCGCCAAGGAAATTAATATTGAATTGATTGTTAGCTTCTCGTTCGCGGGAAGCGGCGTCAATCTGAAACACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATTGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCTAAGGGCACGTCTGCCTGGGTCAGTCACGCATCTAGTTGCCCCCTGACCAACTAATCTTCTAAGAGATTTTGTCGGTTTGGGGGCGGAAATTAGCCTCCTGTGGACCATGTTGTGCGGCTGGCGTAAAACTGAGTCTATGGTGACGAATGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGGCTTGTCGTGTGAATGTCCGTCATCTTATAAGGCTCAATGACCCTTAGGCGCCAAAAACTTTGGCACTTCGA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCTAGTTGCCCCCTGACCAACTAATCTTCTAAGAGATTTTGTCGGTTTGGGGGCGGAAATTAGCCTCCTGTGGACCATGTTGTGCGGCTGGCGTAAAACTGAGTCTATGGTGACGAATGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTGGCTTGTCGTGTGAATGTCCGTCATCTTATAAGGCTCAATGACCCTTAGGCGCCAAAAACTTTGGCACTTCGA
Taxonomic Information

Plant ID: NPO1576
Plant Latin Name: Anthriscus Sylvestris
Taxonomy Genus: Anthriscus
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 48027
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Kenya; Tanzania; Rwanda; Finland

Traditional Medicine System:


Medicinal Functions:

Tonic

Geographical Distribution

Kenya; Tanzania; Finland; Rwanda

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

82 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


16 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

19 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99530

Ingredient ID: NPC9824

Ingredient ID: NPC94975

Ingredient ID: NPC94188

Ingredient ID: NPC93226

Ingredient ID: NPC91014

Ingredient ID: NPC90276

Ingredient ID: NPC88515

Ingredient ID: NPC82988

Ingredient ID: NPC80248

Ingredient ID: NPC80230

Ingredient ID: NPC79715

Ingredient ID: NPC78094

Ingredient ID: NPC76863

Ingredient ID: NPC7456

Ingredient ID: NPC67441

Ingredient ID: NPC65858

Ingredient ID: NPC64769

Ingredient ID: NPC52277

Ingredient ID: NPC4982

Ingredient ID: NPC44563

Ingredient ID: NPC44400

Ingredient ID: NPC296334

Ingredient ID: NPC288494

Ingredient ID: NPC286334

Ingredient ID: NPC282489

Ingredient ID: NPC276814

Ingredient ID: NPC274324

Ingredient ID: NPC273247

Ingredient ID: NPC264633

Ingredient ID: NPC252191

Ingredient ID: NPC250415

Ingredient ID: NPC242473

Ingredient ID: NPC240451

Ingredient ID: NPC236781

Ingredient ID: NPC231607

Ingredient ID: NPC230318

Ingredient ID: NPC227415

Ingredient ID: NPC223464

Ingredient ID: NPC220397

Ingredient ID: NPC210354

Ingredient ID: NPC207732

Ingredient ID: NPC204012

Ingredient ID: NPC20145

Ingredient ID: NPC201333

Ingredient ID: NPC200566

Ingredient ID: NPC199459

Ingredient ID: NPC197984

Ingredient ID: NPC194873

Ingredient ID: NPC194674

Ingredient ID: NPC187583

Ingredient ID: NPC187058

Ingredient ID: NPC179002

Ingredient ID: NPC177035

Ingredient ID: NPC176224

Ingredient ID: NPC174918

Ingredient ID: NPC173319

Ingredient ID: NPC172896

Ingredient ID: NPC171069

Ingredient ID: NPC169818

Ingredient ID: NPC160854

Ingredient ID: NPC157574

Ingredient ID: NPC157046

Ingredient ID: NPC153453

Ingredient ID: NPC149634

Ingredient ID: NPC147545

Ingredient ID: NPC14704

Ingredient ID: NPC142718

Ingredient ID: NPC141425

Ingredient ID: NPC140592

Ingredient ID: NPC129938

Ingredient ID: NPC120773

Ingredient ID: NPC118754

Ingredient ID: NPC117482

Ingredient ID: NPC115723

Ingredient ID: NPC111701

Ingredient ID: NPC108659

Ingredient ID: NPC107369

Ingredient ID: NPC103935

Ingredient ID: NPC103197

Ingredient ID: NPC102060

Ingredient ID: NPC101100