• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Bupleurum Aureum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAATCCTGAATCGAAGAAGCGACCCGAGCACATGTTTTAAGACGGGGCCAGCGGTCGTCGGCCTCGGCCTTGACGGCTGCGAACCCTAGGCCGGGGGTCGCCTAGTTGTGCCCGCCGGCCCAAAACCTAACCGGGCGCGGAATGCGCCAAGGAAATCGAAACTGAACGGGATGCCTCCGCCCCGTTTGAGGGGGGGTTGACATCCTTCTGAGAAAGAAA

Click for details-----ITS2

AAAGCTTTGCCCCTCCGCAGCTCACTCAAAGCGAGTCGTTGCTGTTCGGGGGGCGGAAAGTGACCTCCCGTGCCTCGTCGTGCGGCTGGTTTAAAAGAGAGTCTCCGGAGATCGGAAAACGCAACATTGGTGGAAGTCATTACGCACCTCTTGCCATCTTGCGCTGAGCCCGTTTACTCTGTGAGCCACAGCGACCCTTTGGCGCCGCCCCAGGTGCGCGCTCGAACTGTGACCCCAGGT
Taxonomic Information

Plant ID: NPO15723
Plant Latin Name: Bupleurum Aureum
Taxonomy Genus: Bupleurum
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 428561
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

99 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


97 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

9 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99486

Ingredient ID: NPC9440

Ingredient ID: NPC91216

Ingredient ID: NPC83264

Ingredient ID: NPC81805

Ingredient ID: NPC79417

Ingredient ID: NPC75643

Ingredient ID: NPC6875

Ingredient ID: NPC6527

Ingredient ID: NPC65043

Ingredient ID: NPC63743

Ingredient ID: NPC61872

Ingredient ID: NPC61533

Ingredient ID: NPC5441

Ingredient ID: NPC51265

Ingredient ID: NPC50413

Ingredient ID: NPC50125

Ingredient ID: NPC46446

Ingredient ID: NPC45940

Ingredient ID: NPC44122

Ingredient ID: NPC40065

Ingredient ID: NPC39488

Ingredient ID: NPC36363

Ingredient ID: NPC35802

Ingredient ID: NPC33259

Ingredient ID: NPC318696

Ingredient ID: NPC311422

Ingredient ID: NPC309135

Ingredient ID: NPC306215

Ingredient ID: NPC299703

Ingredient ID: NPC29890

Ingredient ID: NPC29864

Ingredient ID: NPC294836

Ingredient ID: NPC294494

Ingredient ID: NPC293714

Ingredient ID: NPC290443

Ingredient ID: NPC285881

Ingredient ID: NPC285265

Ingredient ID: NPC284238

Ingredient ID: NPC281768

Ingredient ID: NPC276738

Ingredient ID: NPC275148

Ingredient ID: NPC273820

Ingredient ID: NPC271977

Ingredient ID: NPC270831

Ingredient ID: NPC270569

Ingredient ID: NPC269429

Ingredient ID: NPC267727

Ingredient ID: NPC266940

Ingredient ID: NPC266712

Ingredient ID: NPC26574

Ingredient ID: NPC26431

Ingredient ID: NPC261405

Ingredient ID: NPC259315

Ingredient ID: NPC257421

Ingredient ID: NPC253165

Ingredient ID: NPC253090

Ingredient ID: NPC248182

Ingredient ID: NPC243860

Ingredient ID: NPC241081

Ingredient ID: NPC23765

Ingredient ID: NPC236709

Ingredient ID: NPC235292

Ingredient ID: NPC229622

Ingredient ID: NPC228433

Ingredient ID: NPC226169

Ingredient ID: NPC225665

Ingredient ID: NPC225507

Ingredient ID: NPC224651

Ingredient ID: NPC223461

Ingredient ID: NPC218410

Ingredient ID: NPC217763

Ingredient ID: NPC216333

Ingredient ID: NPC216267

Ingredient ID: NPC216081

Ingredient ID: NPC214535

Ingredient ID: NPC211579

Ingredient ID: NPC208486

Ingredient ID: NPC201856

Ingredient ID: NPC201399

Ingredient ID: NPC193238

Ingredient ID: NPC186422

Ingredient ID: NPC177676

Ingredient ID: NPC176874

Ingredient ID: NPC175308

Ingredient ID: NPC165122

Ingredient ID: NPC163021

Ingredient ID: NPC159789

Ingredient ID: NPC152195

Ingredient ID: NPC14208

Ingredient ID: NPC135046

Ingredient ID: NPC133922

Ingredient ID: NPC132840

Ingredient ID: NPC125575

Ingredient ID: NPC118736

Ingredient ID: NPC108896

Ingredient ID: NPC105224

Ingredient ID: NPC103267

Ingredient ID: NPC102759