• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Astragalus Mongholicus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CATTGTCGATGCCTTACATGCAGACCAACTCGTGAATTTGTTTGAATACATAGGGATGGCACGGGTGTTTTGGCACCACGACCTCCCTTTGGGTAGGAGGGGGTGCGTCCCCCTCTTGCCTGAACACAAACCCCGGCGTTCAATGCGCCAAGGAACTAAAATTCGATCAATGCGCCCCGTCGGCCCGGAGACGGTGCTCTGGCGGTGGTGCCTTGTCACTGATACAGAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACTATCGTTGCCCAATGCCTATTGCAGTGCAATAGGAATTTCTAGGGCGAATGATGGCTTCCCGTGAGCGTTGTTGCCTCGCGGTTGGTTGAAAATCGAGTCCTTGGTAGGGTGTGCCATGATAGATGGTGGTCGAGTTAGAACGATACCGATCATGTGCATGCTCCCCAAAATATGGCCTCTATGACCCACACGCGTCTTTTGACGCTCATGACGAGACCTCAGGTCAGGCGGGTAC

Click for details-----ITS1

AAGGATCATTGTCGATGCCTTACATGCAGACCAACTAGTGAATCTGTTTGAATACTTAGGGATGGCTGGGGTGTTTTGCACCACGACCTCCCTTTGGGTGGGGGGTGGTGCGCAATGCGTTCCCCCTCCTGCCCGAACACAAACCCCGGCGCTCAATGCGCCAAGGAACTAAAATTCGATCAATGTGCCCCGTCGGCCCGGAGACGGTGCTTCGGCGGTGGTGCCTTGTCACATGATACAGAA

Click for details-----ITS2

ATCGTTGCCCGATGCCTATTGCAGTGTGATAGGAATTTTTAGGGCGAATGATGGCTTCCCGTGAGCGTTGTTGCCTCGCGGTTGGTTGAAAATTGAGTCCTTGGTGGGGTGTGCCATGATAGATGGTGGTCGAGTTAGCACGAGACCCATCATGTGCATGCTCCCCAAAATATGGCCTCTATGACCCACACGTGTCTTTGGACGCTCATG
Taxonomic Information

Plant ID: NPO15715
Plant Latin Name: Astragalus Mongholicus
Taxonomy Genus: Astragalus
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 119829
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
South Korea; China

Traditional Medicine System:
TCM


Medicinal Functions:

Cardiotonic; Diuretic; Vasodilator

Geographical Distribution

South Korea; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

144 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


63 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

42 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98304

Ingredient ID: NPC97241

Ingredient ID: NPC89518

Ingredient ID: NPC89088

Ingredient ID: NPC87628

Ingredient ID: NPC8674

Ingredient ID: NPC85813

Ingredient ID: NPC80710

Ingredient ID: NPC80672

Ingredient ID: NPC74925

Ingredient ID: NPC66700

Ingredient ID: NPC6530

Ingredient ID: NPC61179

Ingredient ID: NPC54472

Ingredient ID: NPC50898

Ingredient ID: NPC49284

Ingredient ID: NPC47283

Ingredient ID: NPC46330

Ingredient ID: NPC45165

Ingredient ID: NPC423

Ingredient ID: NPC39064

Ingredient ID: NPC38877

Ingredient ID: NPC37871

Ingredient ID: NPC37769

Ingredient ID: NPC36408

Ingredient ID: NPC3617

Ingredient ID: NPC36029

Ingredient ID: NPC35565

Ingredient ID: NPC35543

Ingredient ID: NPC33987

Ingredient ID: NPC33117

Ingredient ID: NPC329079

Ingredient ID: NPC328407

Ingredient ID: NPC325026

Ingredient ID: NPC323434

Ingredient ID: NPC319817

Ingredient ID: NPC319449

Ingredient ID: NPC317556

Ingredient ID: NPC317304

Ingredient ID: NPC311308

Ingredient ID: NPC30769

Ingredient ID: NPC305741

Ingredient ID: NPC30096

Ingredient ID: NPC299763

Ingredient ID: NPC299335

Ingredient ID: NPC298895

Ingredient ID: NPC297669

Ingredient ID: NPC295697

Ingredient ID: NPC294548

Ingredient ID: NPC294412

Ingredient ID: NPC294409

Ingredient ID: NPC29403

Ingredient ID: NPC293875

Ingredient ID: NPC292340

Ingredient ID: NPC291428

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC287349

Ingredient ID: NPC279865

Ingredient ID: NPC264059

Ingredient ID: NPC254702

Ingredient ID: NPC250828

Ingredient ID: NPC249045

Ingredient ID: NPC246469

Ingredient ID: NPC243728

Ingredient ID: NPC242950

Ingredient ID: NPC239368

Ingredient ID: NPC238405

Ingredient ID: NPC236657

Ingredient ID: NPC236187

Ingredient ID: NPC234560

Ingredient ID: NPC230627

Ingredient ID: NPC230435

Ingredient ID: NPC230301

Ingredient ID: NPC229729

Ingredient ID: NPC228383

Ingredient ID: NPC22697

Ingredient ID: NPC225778

Ingredient ID: NPC225626

Ingredient ID: NPC221504

Ingredient ID: NPC221461

Ingredient ID: NPC22034

Ingredient ID: NPC218122

Ingredient ID: NPC216900

Ingredient ID: NPC216870

Ingredient ID: NPC213935

Ingredient ID: NPC212474

Ingredient ID: NPC209560

Ingredient ID: NPC208361

Ingredient ID: NPC207803

Ingredient ID: NPC207656

Ingredient ID: NPC206050

Ingredient ID: NPC20306

Ingredient ID: NPC202431

Ingredient ID: NPC198358

Ingredient ID: NPC194653

Ingredient ID: NPC19174

Ingredient ID: NPC186176

Ingredient ID: NPC184831

Ingredient ID: NPC184368

Ingredient ID: NPC183774

Ingredient ID: NPC18349

Ingredient ID: NPC181209

Ingredient ID: NPC179950

Ingredient ID: NPC1775

Ingredient ID: NPC176740

Ingredient ID: NPC170932

Ingredient ID: NPC16728

Ingredient ID: NPC162822

Ingredient ID: NPC16079

Ingredient ID: NPC156461

Ingredient ID: NPC152538

Ingredient ID: NPC152166

Ingredient ID: NPC146791

Ingredient ID: NPC145708

Ingredient ID: NPC143799

Ingredient ID: NPC142860

Ingredient ID: NPC142264

Ingredient ID: NPC141078

Ingredient ID: NPC137816

Ingredient ID: NPC136071

Ingredient ID: NPC13473

Ingredient ID: NPC133671

Ingredient ID: NPC131624

Ingredient ID: NPC130683

Ingredient ID: NPC130599

Ingredient ID: NPC125784

Ingredient ID: NPC125062

Ingredient ID: NPC123146

Ingredient ID: NPC1216

Ingredient ID: NPC121585

Ingredient ID: NPC121522

Ingredient ID: NPC117820

Ingredient ID: NPC116775

Ingredient ID: NPC116649

Ingredient ID: NPC1148

Ingredient ID: NPC11413

Ingredient ID: NPC111897

Ingredient ID: NPC111888

Ingredient ID: NPC111376

Ingredient ID: NPC109813

Ingredient ID: NPC108227

Ingredient ID: NPC106179

Ingredient ID: NPC102832