• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Sideritis Chamaedryfolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TTCACAAACAAACCGGCGCCGCGTGGCGGGGGAAACCCCGAGAYGCGGCCCGATCCCGCCGGCGCTCGCGCCGCGYGGGCTAACRAACTCGGGCGCGGAATGCGCCAAGGAAAACGAAATGGAGCGCCCCCCTCCCCCGAGCGCCCCGTCCGCGGGGACACGGGGGGGAAAGGGACGCCTATCGAATGTCTAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO15640
Plant Latin Name: Sideritis Chamaedryfolia
Taxonomy Genus: Sideritis
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 155237
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

27 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


2 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

6 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96015

Ingredient ID: NPC67812

Ingredient ID: NPC56988

Ingredient ID: NPC34833

Ingredient ID: NPC3355

Ingredient ID: NPC303422

Ingredient ID: NPC302456

Ingredient ID: NPC289064

Ingredient ID: NPC287881

Ingredient ID: NPC275053

Ingredient ID: NPC254560

Ingredient ID: NPC224528

Ingredient ID: NPC201170

Ingredient ID: NPC197561

Ingredient ID: NPC161571

Ingredient ID: NPC15920

Ingredient ID: NPC15109

Ingredient ID: NPC148516

Ingredient ID: NPC147063

Ingredient ID: NPC144785

Ingredient ID: NPC143226

Ingredient ID: NPC142153

Ingredient ID: NPC141647

Ingredient ID: NPC13900

Ingredient ID: NPC129391

Ingredient ID: NPC106083

Ingredient ID: NPC103795