• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Trifolium Pannonicum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATGCCTCACATGCAGACCAACACGTGAATTAGTTTCAACACATAGGGTTGGTTCGAGGTGTTCACCACCTCAGCTTGCCACTGGTTCGGAGGTGGACGACACAKTGCGTTCCCCTTTGTGCCAAAACTCAAACCCCCGGCGCTGAATGCGTCAAGGAATTTAAAATTTGCTCTGATCGCACCTGCATGGCACCGGAGACGGTTTTCGTGYGGGTTGTGTTCTGACACATAATATAGAATGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCACGTCTGCCTGGGCGTCACATATCGAAGCCTCTTGCCAATTTCCTAATGATAGGYATTGTGCAGGGTGAATGTTGGCCTCCCGTGAGCTCCATCGTCTCATGGTTGGTTGAAAATCGAGACCTTGGTAGTTTGTGCCATGATAGATGGTGGTTGTGTTACGCATGAGTCCAAATAATCATGTGCCGCTCTATCGAATTTAGCCTCTTTTACCCACATGTGTTTCTAAATGCTCGTG

Click for details-----ITS1

TCGATGCCTCACATGCAGACCAACACGTGAATTAGTTTCAACACATAGGGTTGGTTCGAGGTGTTCACCACCTCAGCTTGCCACTGGTTCGGAGGTGGACGACACAKTGCGTTCCCCTTTGTGCCAAAACTCAAACCCCCGGCGCTGAATGCGTCAAGGAATTTAAAATTTGCTCTGATCGCACCTGCATGGCACCGGAGACGGTTTTCGTGYGGGTTGTGTTCTGACACATAATATAGAA

Click for details-----ITS2

ATCGAAGCCTCTTGCCAATTTCCTAATGATAGGYATTGTGCAGGGTGAATGTTGGCCTCCCGTGAGCTCCATCGTCTCATGGTTGGTTGAAAATCGAGACCTTGGTAGTTTGTGCCATGATAGATGGTGGTTGTGTTACGCATGAGTCCAAATAATCATGTGCCGCTCTATCGAATTTAGCCTCTTTTACCCACATGTGTTTCTAAATGCTCGTG
Taxonomic Information

Plant ID: NPO15600
Plant Latin Name: Trifolium Pannonicum
Taxonomy Genus: Trifolium
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 97032
Plant-of-the-World-Online: 523506-1

Used in Medicines

Country/Region:
Albania

Traditional Medicine System:

Geographical Distribution

Ukraine; Romania; Belarus; Italy; Poland; France; Morocco; Albania; Greece; Hungary; Bulgaria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

160 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


142 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

19 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99531

Ingredient ID: NPC98934

Ingredient ID: NPC97491

Ingredient ID: NPC97026

Ingredient ID: NPC93665

Ingredient ID: NPC89953

Ingredient ID: NPC88351

Ingredient ID: NPC87424

Ingredient ID: NPC86471

Ingredient ID: NPC84989

Ingredient ID: NPC83368

Ingredient ID: NPC81201

Ingredient ID: NPC79917

Ingredient ID: NPC78618

Ingredient ID: NPC72942

Ingredient ID: NPC65960

Ingredient ID: NPC6251

Ingredient ID: NPC62077

Ingredient ID: NPC61396

Ingredient ID: NPC60355

Ingredient ID: NPC60245

Ingredient ID: NPC58872

Ingredient ID: NPC58605

Ingredient ID: NPC57460

Ingredient ID: NPC53939

Ingredient ID: NPC5327

Ingredient ID: NPC47158

Ingredient ID: NPC471

Ingredient ID: NPC46081

Ingredient ID: NPC44666

Ingredient ID: NPC43874

Ingredient ID: NPC41215

Ingredient ID: NPC40316

Ingredient ID: NPC38748

Ingredient ID: NPC37230

Ingredient ID: NPC35734

Ingredient ID: NPC35220

Ingredient ID: NPC34504

Ingredient ID: NPC3149

Ingredient ID: NPC31330

Ingredient ID: NPC311829

Ingredient ID: NPC31173

Ingredient ID: NPC311352

Ingredient ID: NPC308956

Ingredient ID: NPC307539

Ingredient ID: NPC30743

Ingredient ID: NPC306701

Ingredient ID: NPC306336

Ingredient ID: NPC306085

Ingredient ID: NPC301637

Ingredient ID: NPC30016

Ingredient ID: NPC298299

Ingredient ID: NPC298035

Ingredient ID: NPC297248

Ingredient ID: NPC297147

Ingredient ID: NPC294445

Ingredient ID: NPC28657

Ingredient ID: NPC283696

Ingredient ID: NPC282224

Ingredient ID: NPC280381

Ingredient ID: NPC280223

Ingredient ID: NPC28008

Ingredient ID: NPC27888

Ingredient ID: NPC278859

Ingredient ID: NPC277819

Ingredient ID: NPC274923

Ingredient ID: NPC274422

Ingredient ID: NPC270710

Ingredient ID: NPC26945

Ingredient ID: NPC269052

Ingredient ID: NPC267228

Ingredient ID: NPC264386

Ingredient ID: NPC26283

Ingredient ID: NPC261649

Ingredient ID: NPC258784

Ingredient ID: NPC25872

Ingredient ID: NPC258071

Ingredient ID: NPC257444

Ingredient ID: NPC256402

Ingredient ID: NPC256058

Ingredient ID: NPC255257

Ingredient ID: NPC253875

Ingredient ID: NPC253123

Ingredient ID: NPC252520

Ingredient ID: NPC252440

Ingredient ID: NPC251061

Ingredient ID: NPC244002

Ingredient ID: NPC243136

Ingredient ID: NPC24272

Ingredient ID: NPC239406

Ingredient ID: NPC239393

Ingredient ID: NPC238274

Ingredient ID: NPC237380

Ingredient ID: NPC234908

Ingredient ID: NPC234829

Ingredient ID: NPC234722

Ingredient ID: NPC233606

Ingredient ID: NPC232853

Ingredient ID: NPC231465

Ingredient ID: NPC228760

Ingredient ID: NPC22748

Ingredient ID: NPC226224

Ingredient ID: NPC226164

Ingredient ID: NPC226090

Ingredient ID: NPC224565

Ingredient ID: NPC224141

Ingredient ID: NPC222429

Ingredient ID: NPC222302

Ingredient ID: NPC221433

Ingredient ID: NPC216630

Ingredient ID: NPC216066

Ingredient ID: NPC21140

Ingredient ID: NPC20882

Ingredient ID: NPC208315

Ingredient ID: NPC207176

Ingredient ID: NPC204205

Ingredient ID: NPC204161

Ingredient ID: NPC20086

Ingredient ID: NPC197690

Ingredient ID: NPC196682

Ingredient ID: NPC194314

Ingredient ID: NPC189598

Ingredient ID: NPC189565

Ingredient ID: NPC185130

Ingredient ID: NPC180712

Ingredient ID: NPC180594

Ingredient ID: NPC173400

Ingredient ID: NPC172442

Ingredient ID: NPC17182

Ingredient ID: NPC170069

Ingredient ID: NPC162986

Ingredient ID: NPC159599

Ingredient ID: NPC157956

Ingredient ID: NPC156339

Ingredient ID: NPC156119

Ingredient ID: NPC154465

Ingredient ID: NPC148874

Ingredient ID: NPC143397

Ingredient ID: NPC141707

Ingredient ID: NPC140924

Ingredient ID: NPC139788

Ingredient ID: NPC136902

Ingredient ID: NPC135013

Ingredient ID: NPC133788

Ingredient ID: NPC129581

Ingredient ID: NPC128844

Ingredient ID: NPC125359

Ingredient ID: NPC122652

Ingredient ID: NPC121112

Ingredient ID: NPC121108

Ingredient ID: NPC119203

Ingredient ID: NPC118501

Ingredient ID: NPC116413

Ingredient ID: NPC113733

Ingredient ID: NPC112486

Ingredient ID: NPC112212

Ingredient ID: NPC110214

Ingredient ID: NPC106792

Ingredient ID: NPC103931

Ingredient ID: NPC10334