• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Cnidium Monnieri


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTCAACAATTTGGGCAAGCGTCGGGGGGCCTCGGTCTCCTGTCTGCGAATCCCTGGTAGGTGGTCACTCTCGGGTGGCCACTGGCCTACAAAATCATTTGGGCGCGGAATGCGCCAAGGACCTTAAAACTGAATTGTACGTCCGTATCCCGTTAGCGGGCAGCGGCGTCATTCCAAAACACAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCCACTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCTTGCCCACAAACCACTCACACCTGAGAAGTTGTGCCGGTTTGGGGGCGGAAACTGGCCTCCCGTACCTTGTCGTGCGGTTGGCGGAAAAACGAGTCTCCGGCGATGGACGTCGCGACATCGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGCGCGAATCCTCGTCATCTTAGCGAGCTCCAGGACCCTTAGGCAGCACACACTCTGTGCGCATCGA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGTCTTGCCCACAAACCACTCACACCTGAGAAGTTGTGCCGGTTTGGGGGCGGAAACTGGCCTCCCGTACCTTGTCGTGCGGTTGGCGGAAAAACGAGTCTCCGGCGATGGACGTCGCGACATCGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGCGCGAATCCTCGTCATCTTAGCGAGCTCCAGGACCCTTAGGCAGCACACACTCTGTGCGCATCGA
Taxonomic Information

Plant ID: NPO15544
Plant Latin Name: Cnidium Monnieri
Taxonomy Genus: Cnidium
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 94007
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
South Korea; China

Traditional Medicine System:
TCM


Medicinal Functions:

Antipruritic; Antirheumatic; Aphrodisiac; Astringent; Carminative; Sedative; Vermifuge; Vulnerary

Geographical Distribution

South Korea; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

141 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


105 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

65 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9880

Ingredient ID: NPC96286

Ingredient ID: NPC92656

Ingredient ID: NPC91574

Ingredient ID: NPC89546

Ingredient ID: NPC87828

Ingredient ID: NPC87304

Ingredient ID: NPC86941

Ingredient ID: NPC86538

Ingredient ID: NPC78551

Ingredient ID: NPC78021

Ingredient ID: NPC76145

Ingredient ID: NPC76029

Ingredient ID: NPC74539

Ingredient ID: NPC74484

Ingredient ID: NPC71703

Ingredient ID: NPC7106

Ingredient ID: NPC67986

Ingredient ID: NPC66577

Ingredient ID: NPC65861

Ingredient ID: NPC56913

Ingredient ID: NPC55149

Ingredient ID: NPC54416

Ingredient ID: NPC52005

Ingredient ID: NPC51986

Ingredient ID: NPC51189

Ingredient ID: NPC51146

Ingredient ID: NPC470608

Ingredient ID: NPC470607

Ingredient ID: NPC470606

Ingredient ID: NPC470605

Ingredient ID: NPC470604

Ingredient ID: NPC470603

Ingredient ID: NPC43114

Ingredient ID: NPC42262

Ingredient ID: NPC42245

Ingredient ID: NPC35273

Ingredient ID: NPC34857

Ingredient ID: NPC34764

Ingredient ID: NPC33986

Ingredient ID: NPC33807

Ingredient ID: NPC33320

Ingredient ID: NPC32021

Ingredient ID: NPC3155

Ingredient ID: NPC31371

Ingredient ID: NPC313036

Ingredient ID: NPC31094

Ingredient ID: NPC310861

Ingredient ID: NPC307783

Ingredient ID: NPC307412

Ingredient ID: NPC301585

Ingredient ID: NPC300649

Ingredient ID: NPC299131

Ingredient ID: NPC297788

Ingredient ID: NPC296380

Ingredient ID: NPC296115

Ingredient ID: NPC294136

Ingredient ID: NPC291545

Ingredient ID: NPC290189

Ingredient ID: NPC290078

Ingredient ID: NPC28992

Ingredient ID: NPC286233

Ingredient ID: NPC277917

Ingredient ID: NPC276761

Ingredient ID: NPC275856

Ingredient ID: NPC26974

Ingredient ID: NPC268950

Ingredient ID: NPC268164

Ingredient ID: NPC258750

Ingredient ID: NPC253757

Ingredient ID: NPC251059

Ingredient ID: NPC244815

Ingredient ID: NPC244464

Ingredient ID: NPC243509

Ingredient ID: NPC239406

Ingredient ID: NPC234536

Ingredient ID: NPC233533

Ingredient ID: NPC231738

Ingredient ID: NPC230301

Ingredient ID: NPC227670

Ingredient ID: NPC227378

Ingredient ID: NPC227049

Ingredient ID: NPC22678

Ingredient ID: NPC223455

Ingredient ID: NPC218918

Ingredient ID: NPC216630

Ingredient ID: NPC214909

Ingredient ID: NPC214710

Ingredient ID: NPC211158

Ingredient ID: NPC209912

Ingredient ID: NPC209275

Ingredient ID: NPC207894

Ingredient ID: NPC206987

Ingredient ID: NPC206478

Ingredient ID: NPC204200

Ingredient ID: NPC201581

Ingredient ID: NPC20120

Ingredient ID: NPC199557

Ingredient ID: NPC197907

Ingredient ID: NPC197571

Ingredient ID: NPC196907

Ingredient ID: NPC196490

Ingredient ID: NPC194691

Ingredient ID: NPC191154

Ingredient ID: NPC190810

Ingredient ID: NPC187347

Ingredient ID: NPC187145

Ingredient ID: NPC186996

Ingredient ID: NPC185066

Ingredient ID: NPC184924

Ingredient ID: NPC179524

Ingredient ID: NPC17408

Ingredient ID: NPC16722

Ingredient ID: NPC166362

Ingredient ID: NPC164067

Ingredient ID: NPC159993

Ingredient ID: NPC15819

Ingredient ID: NPC155904

Ingredient ID: NPC154185

Ingredient ID: NPC154176

Ingredient ID: NPC149203

Ingredient ID: NPC149184

Ingredient ID: NPC148235

Ingredient ID: NPC141777

Ingredient ID: NPC13991

Ingredient ID: NPC139891

Ingredient ID: NPC139557

Ingredient ID: NPC138925

Ingredient ID: NPC136996

Ingredient ID: NPC135154

Ingredient ID: NPC130530

Ingredient ID: NPC127122

Ingredient ID: NPC126240

Ingredient ID: NPC120926

Ingredient ID: NPC115096

Ingredient ID: NPC114239

Ingredient ID: NPC113404

Ingredient ID: NPC109813

Ingredient ID: NPC108706

Ingredient ID: NPC10650

Ingredient ID: NPC10241