• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Corymbia Citriodora


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

CATTGTCGAATCCTGCCTAGCAGAACGACCAGAGAACCGGTAAAAAACTCGATGGGGATGGCGAGCTCCGCTGGCCGTCCCTCGATGTCGGGGATCGCGCGGGTGCCTCCGGYGCCCGTGYGTCCTCCTCGGCAGCACAACGAACCCCGGCGCGGAACGCGCCAAGGAACTCGAACAAGAGTGCGACGCTCCCGCCGCCCCGGACACGGTGCGCGCGCGGGATGCCGTGCAATCTCCTATTAGTCATAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO15538
Plant Latin Name: Corymbia Citriodora
Taxonomy Genus: Corymbia
Taxonomy Family: Myrtaceae

Plant External Links:

NCBI TaxonomyDB: 34329
Plant-of-the-World-Online: 986336-1

Used in Medicines

Country/Region:
Kenya; Tanzania; Australia; Rwanda; India

Traditional Medicine System:
Indian Folk

Geographical Distribution

Australia; Bangladesh; Cuba; El Salvador; Gambia; Tanzania; India; Zimbabwe; Zambia; United States; Morocco; Trinidad and Tobago; Rwanda; China; Mozambique; Guinea-Bissau; Kenya; Dominican Republic; Malawi; Uganda

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

106 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


85 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

61 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95969

Ingredient ID: NPC95003

Ingredient ID: NPC93559

Ingredient ID: NPC90803

Ingredient ID: NPC85813

Ingredient ID: NPC84824

Ingredient ID: NPC80090

Ingredient ID: NPC7965

Ingredient ID: NPC79576

Ingredient ID: NPC75584

Ingredient ID: NPC71639

Ingredient ID: NPC67508

Ingredient ID: NPC62290

Ingredient ID: NPC57788

Ingredient ID: NPC54321

Ingredient ID: NPC54145

Ingredient ID: NPC52205

Ingredient ID: NPC51700

Ingredient ID: NPC49168

Ingredient ID: NPC491219

Ingredient ID: NPC488289

Ingredient ID: NPC488288

Ingredient ID: NPC488287

Ingredient ID: NPC47844

Ingredient ID: NPC43276

Ingredient ID: NPC41163

Ingredient ID: NPC3779

Ingredient ID: NPC36054

Ingredient ID: NPC34764

Ingredient ID: NPC34429

Ingredient ID: NPC335868

Ingredient ID: NPC331620

Ingredient ID: NPC330834

Ingredient ID: NPC312292

Ingredient ID: NPC310562

Ingredient ID: NPC305327

Ingredient ID: NPC30430

Ingredient ID: NPC289388

Ingredient ID: NPC288267

Ingredient ID: NPC287331

Ingredient ID: NPC285267

Ingredient ID: NPC282974

Ingredient ID: NPC282694

Ingredient ID: NPC280821

Ingredient ID: NPC276009

Ingredient ID: NPC27532

Ingredient ID: NPC274613

Ingredient ID: NPC273326

Ingredient ID: NPC269823

Ingredient ID: NPC26906

Ingredient ID: NPC26536

Ingredient ID: NPC264779

Ingredient ID: NPC264317

Ingredient ID: NPC257124

Ingredient ID: NPC255042

Ingredient ID: NPC254199

Ingredient ID: NPC249815

Ingredient ID: NPC24824

Ingredient ID: NPC246026

Ingredient ID: NPC244705

Ingredient ID: NPC243728

Ingredient ID: NPC242580

Ingredient ID: NPC230920

Ingredient ID: NPC230301

Ingredient ID: NPC228824

Ingredient ID: NPC22098

Ingredient ID: NPC215242

Ingredient ID: NPC214584

Ingredient ID: NPC214299

Ingredient ID: NPC210560

Ingredient ID: NPC208330

Ingredient ID: NPC202189

Ingredient ID: NPC195246

Ingredient ID: NPC194208

Ingredient ID: NPC1940

Ingredient ID: NPC193180

Ingredient ID: NPC192744

Ingredient ID: NPC190036

Ingredient ID: NPC184049

Ingredient ID: NPC182840

Ingredient ID: NPC181225

Ingredient ID: NPC180871

Ingredient ID: NPC179024

Ingredient ID: NPC178134

Ingredient ID: NPC176869

Ingredient ID: NPC172833

Ingredient ID: NPC171928

Ingredient ID: NPC168718

Ingredient ID: NPC165651

Ingredient ID: NPC160996

Ingredient ID: NPC15912

Ingredient ID: NPC158956

Ingredient ID: NPC149203

Ingredient ID: NPC143799

Ingredient ID: NPC13991

Ingredient ID: NPC138113

Ingredient ID: NPC136176

Ingredient ID: NPC125575

Ingredient ID: NPC123965

Ingredient ID: NPC123658

Ingredient ID: NPC110899

Ingredient ID: NPC109813

Ingredient ID: NPC106200

Ingredient ID: NPC103213

Ingredient ID: NPC102266

Ingredient ID: NPC101475