CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Glochidion Zeylanicum

Example Image

PLANiTS DNA barcode

TCGATACCTTGTCGTATGACCCGCGAACAAGTTTAATCACNGNGGAAGGAGCCCTGTGCTCCTGAAGCAAGGCCCGTGGGGTGCTATGCTCCTTGCGGAAGCCACGTAAACAAACCCCGGCGCGGAAAGCGCCAAGGAAAATGAACAGAAAAGCGAGATCTCTACAATCACCTCGGAAACGATGTGTGCATGGTAGTTGTTTCTNCTTTCATAACCAAAA

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO15526
Plant Latin Name: Glochidion Zeylanicum
Taxonomy Genus: Glochidion
Taxonomy Family: Phyllanthaceae

Plant External Links:

NCBI TaxonomyDB: 271535
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

16 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

10 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

7 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC98098

Ingredient ID: NPC72067

Ingredient ID: NPC71439

Ingredient ID: NPC6292

Ingredient ID: NPC57469

Ingredient ID: NPC48535

Ingredient ID: NPC304045

Ingredient ID: NPC293803

Ingredient ID: NPC236709

Ingredient ID: NPC236353

Ingredient ID: NPC224651

Ingredient ID: NPC208265

Ingredient ID: NPC181508

Ingredient ID: NPC128713

Ingredient ID: NPC116119

Ingredient ID: NPC115727

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Peptide receptor (family A GPCR)	TSHR	Thyroid stimulating hormone receptor	P16473	CHEMBL1963
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Transcription factor	TP53	Cellular tumor antigen p53	P04637	CHEMBL4096

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	6

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01321164	Fumaric Acid Versus Fumaric Acid Plus Narrow Band Type B Ultraviolet (UVB) for Psoriasis	psoriasis	Fumaric Acid (NPC224651)	NP level
NCT02634801	A Study of Ixekizumab (LY2439821) in Participants With Moderate-to-Severe Plaque Psoriasis Naive to Systemic Treatment	psoriasis	Fumaric Acid (NPC224651)	NP level
NCT02474082	Study of Secukinumab Compared to Fumaderm® in Adults With Moderate to Severe Psoriasis.	psoriasis	Fumaric Acid (NPC224651)	NP level
NCT04649203	Cytoflavin in the Treatment of Patients With Diabetic Polyneuropathy	diabetic neuropathy	Succinic Acid (NPC236709)	NP level
NCT01352988	Efficacy and Safety of Fumaric Acid Esters (Fumaderm®) in the Treatment of Patients With Cutaneous Lupus Erythematosus	cutaneous lupus erythematosus	Fumaric Acid (NPC224651)	NP level
NCT02951533	A Study to Compare the Efficacy of Guselkumab to Fumaric Acid Esters for the Treatment of Participants With Moderate to Severe Plaque Psoriasis	psoriasis	Fumaric Acid (NPC224651)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	NCT01321164,NCT02474082,NCT02634801,NCT02951533
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	OR51E2,TP53,TSHR,LMNA
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	OR51E2,TP53,LMNA
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	TP53,TSHR
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	TP53,TSHR
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	OR51E2,TSHR
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	OR51E2,LMNA
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	OR51E2,LMNA
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	OR51E2,TSHR
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	TSHR,LMNA
Esophageal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	TP53
Hypo-thyroidism Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A00	TSHR
Bladder cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	TP53
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	TP53
Cervical cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C77	TP53
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	TP53
Fallopian tube cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C74	TP53
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	TP53
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	TP53
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	TP53
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	TP53
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	TSHR
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	TP53
Kidney failure Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB60-GB6Z	TP53
Lip/oral cavity/pharynx neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6E	TP53
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	TP53
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	TP53
Metastatic liver/bile duct neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D80	TP53
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	TP53
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	TP53
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	TP53
Ovarian dysfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80	TP53
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	TP53
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	TP53
Liposarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B59	TP53
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	TP53
Cutaneous lupus erythematosus Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EB50-EB5Z	NCT01352988
Diabetic polyneuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C03.0	NCT04649203
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	TSHR
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	OR51E2
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	TSHR
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	OR51E2
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	TSHR
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	OR51E2
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	OR51E2
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	TSHR
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	OR51E2
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	OR51E2

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Glochidion Zeylanicum

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

16 All known Ingredients in Total

10 Ingredients with Acceptable Bioavailablity

7 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Psoriasis

Diffuse large B-cell lymphomas

Malignant neoplasms of biliary tract, distal bile duct

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Squamous cell carcinoma of bronchus or lung

Adenocarcinoma of pancreas

Mesothelioma of pleura

Other specified malignant neoplasms of kidney, except renal pelvis

Glioblastoma of brain

Esophageal cancer

Hypo-thyroidism

Bladder cancer

Solid tumour/cancer

Cervical cancer

Malignant haematopoietic neoplasm

Fallopian tube cancer

Peritoneal cancer

Stomach cancer

Mature B-cell leukaemia

Endometrial cancer

Thyroid cancer

Brain cancer

Kidney failure

Lip/oral cavity/pharynx neoplasm

Pancreatic cancer

Chronic arterial occlusive disease

Metastatic liver/bile duct neoplasm

Head and neck cancer

Myelodysplastic syndrome

Transplant rejection

Ovarian dysfunction

Colorectal cancer

Ovarian cancer

Liposarcoma

Acute myeloid leukaemia

Cutaneous lupus erythematosus

Diabetic polyneuropathy

Coeliac disease

Pheochromocytoma

Myelodysplastic syndromes, unspecified

Hepatoblastoma

Leishmaniasis

Hepatocellular carcinoma of liver

Superficial ovarian endometriosis

Adenocarcinoma of prostate

Adenocarcinoma of bronchus or lung

Chikungunya virus disease

Carpal tunnel syndrome

Malignant neoplasms of adrenal gland

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities