• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Sideritis Soluta


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCGCCCCCTCCCCCCACCTCGGGGGGGTTGGGGCGGAGATTGGCCCCCCGTGCGCAGCGATGYGCGCGGCCGGCCCAAATCTGAATCCGCCGTCGACGCAATGTCGCGACCAGTGGTGGTTGAATCCTCAACTCGCGTGCTGTCGCACACCGATGCGCCGTCGGTCCGGAGAGAACTGAACCCAAAGGAGCGATCGCGAATCGCGCCCACGACTGCGACCCCAGGTCAGGCGGATCACCCGCT
Taxonomic Information

Plant ID: NPO15456
Plant Latin Name: Sideritis Soluta
Taxonomy Genus: Sideritis
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 155263
Plant-of-the-World-Online: 459099-1

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

27 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


6 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97309

Ingredient ID: NPC82905

Ingredient ID: NPC8179

Ingredient ID: NPC79056

Ingredient ID: NPC77660

Ingredient ID: NPC6221

Ingredient ID: NPC50898

Ingredient ID: NPC294852

Ingredient ID: NPC279121

Ingredient ID: NPC267147

Ingredient ID: NPC258501

Ingredient ID: NPC256006

Ingredient ID: NPC245082

Ingredient ID: NPC232552

Ingredient ID: NPC208482

Ingredient ID: NPC20791

Ingredient ID: NPC203152

Ingredient ID: NPC189219

Ingredient ID: NPC189142

Ingredient ID: NPC183950

Ingredient ID: NPC176740

Ingredient ID: NPC17304

Ingredient ID: NPC161690

Ingredient ID: NPC136699

Ingredient ID: NPC124304

Ingredient ID: NPC121030

Ingredient ID: NPC101294