• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Vitex Rotundifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

GCGAGCGTGCCTCCCTCCCGTCGCGCTCCCACCCCCGTCGGCACGGGCGCTATCGCCTCGTGTCGTGCGGGCTAACGAACCCCGGCGCGGCATGCGCCAAGGAAAACAAAAATGAAGCGCTCACCGCCCGACGCCCCGTTCGCGGAGCGCGCGGGCGGACGGTGCGCCTTTNTGATGTCAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCCTCCTGCGCGTCGCGCTCGCGATGGGGGGGCGGAGACTGGCCTCCCGTGCCCCTCGGCGCGGCTGGCCCAAATGCGATCCCTCGGCGACGCACGTCACGACCAGTGGTGGTTGATCTCAACTCGCGTGCTGTNGTGCGGCGCGGCGTCGTCCGCGGCGGAGTCAACGATGACCC
Taxonomic Information

Plant ID: NPO15454
Plant Latin Name: Vitex Rotundifolia
Taxonomy Genus: Vitex
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 413484
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Australia; China

Traditional Medicine System:
TCM

Geographical Distribution

Australia; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

112 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


79 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

69 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC8747

Ingredient ID: NPC87145

Ingredient ID: NPC85813

Ingredient ID: NPC85550

Ingredient ID: NPC85488

Ingredient ID: NPC84803

Ingredient ID: NPC78551

Ingredient ID: NPC77922

Ingredient ID: NPC76686

Ingredient ID: NPC7349

Ingredient ID: NPC71541

Ingredient ID: NPC70741

Ingredient ID: NPC6984

Ingredient ID: NPC69394

Ingredient ID: NPC68492

Ingredient ID: NPC61474

Ingredient ID: NPC57801

Ingredient ID: NPC55508

Ingredient ID: NPC52961

Ingredient ID: NPC51700

Ingredient ID: NPC482626

Ingredient ID: NPC48208

Ingredient ID: NPC471415

Ingredient ID: NPC471414

Ingredient ID: NPC471413

Ingredient ID: NPC471412

Ingredient ID: NPC471411

Ingredient ID: NPC471410

Ingredient ID: NPC471409

Ingredient ID: NPC471408

Ingredient ID: NPC45572

Ingredient ID: NPC34700

Ingredient ID: NPC324841

Ingredient ID: NPC315603

Ingredient ID: NPC313041

Ingredient ID: NPC303511

Ingredient ID: NPC302347

Ingredient ID: NPC300757

Ingredient ID: NPC300603

Ingredient ID: NPC29952

Ingredient ID: NPC29883

Ingredient ID: NPC298099

Ingredient ID: NPC293183

Ingredient ID: NPC289021

Ingredient ID: NPC288537

Ingredient ID: NPC279121

Ingredient ID: NPC277400

Ingredient ID: NPC272804

Ingredient ID: NPC27252

Ingredient ID: NPC270620

Ingredient ID: NPC264711

Ingredient ID: NPC264317

Ingredient ID: NPC263607

Ingredient ID: NPC263367

Ingredient ID: NPC26229

Ingredient ID: NPC261322

Ingredient ID: NPC260323

Ingredient ID: NPC257582

Ingredient ID: NPC25495

Ingredient ID: NPC254482

Ingredient ID: NPC253878

Ingredient ID: NPC253746

Ingredient ID: NPC249970

Ingredient ID: NPC245004

Ingredient ID: NPC243728

Ingredient ID: NPC242580

Ingredient ID: NPC242203

Ingredient ID: NPC236105

Ingredient ID: NPC233270

Ingredient ID: NPC224684

Ingredient ID: NPC219913

Ingredient ID: NPC219809

Ingredient ID: NPC21894

Ingredient ID: NPC216630

Ingredient ID: NPC213401

Ingredient ID: NPC209970

Ingredient ID: NPC20946

Ingredient ID: NPC208674

Ingredient ID: NPC20619

Ingredient ID: NPC199379

Ingredient ID: NPC18772

Ingredient ID: NPC186305

Ingredient ID: NPC180058

Ingredient ID: NPC1769

Ingredient ID: NPC176300

Ingredient ID: NPC171736

Ingredient ID: NPC16656

Ingredient ID: NPC166441

Ingredient ID: NPC162973

Ingredient ID: NPC160416

Ingredient ID: NPC159418

Ingredient ID: NPC158546

Ingredient ID: NPC156654

Ingredient ID: NPC153982

Ingredient ID: NPC152042

Ingredient ID: NPC1441

Ingredient ID: NPC141777

Ingredient ID: NPC140891

Ingredient ID: NPC137125

Ingredient ID: NPC133966

Ingredient ID: NPC131905

Ingredient ID: NPC131329

Ingredient ID: NPC131192

Ingredient ID: NPC130665

Ingredient ID: NPC121809

Ingredient ID: NPC121158

Ingredient ID: NPC116876

Ingredient ID: NPC115959

Ingredient ID: NPC111888

Ingredient ID: NPC109510

Ingredient ID: NPC107334

Ingredient ID: NPC100665