• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Angelica Decursiva


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TACTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTTAACAATTTGGGCGAGCGTCGGGGGGCCTCGGTCTCCTGTCTTCGAATCCCTGGTAAGTGGCCACTCCCGGGTGGTCACTGGCCTACAAAATCATTCGGGCGCGGAATGCGCCAAGGACCTTAAAACTGAATTGTACGTTCGTATCCCGTTCGCGGGCACCGGCGTCATTCCAAAACACAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCTGAGGGCACGCCTGCCTGGGTGTCACGCATCGTATTGCCTGCAGACCACTCACACCTGAGAAGTTGTGACGGTTTGGGGCGCAAATTGGCCTCCCGTACCTTGTCGTGCGGTTGGCGGAAAAACGAGTCTCCGGCGACGGATGTCGCGACATCGGTGGTTGTGAAAGACCCTCTTGTCTTGTCGCGCGAGTCCTCGTCATNTTAGCGAGCTCCAGGACCCATAGGCAGCACACACTCTGTGCGCTTCGA

Click for details-----ITS1

TACTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTTAACAATTTGGGCGAGCGTCGGGGGGCCTCGGTCTCCTGTCTTCGAATCCCTGGTAAGTGGCCACTCCCGGGTGGTCACTGGCCTACAAAATCATTCGGGCGCGGAATGCGCCAAGGACCTTAAAACTGAATTGTACGTTCGTATCCCGTTCGCGGGCACCGGCGTCATTCCAAAACACAA

Click for details-----ITS2

ATCGTATTGCCTGCAGACCACTCACACCTGAGAAGTTTGTGACGGTTTGGGGCGCAAATTGGCCTCCCGTACCTTGGCCGTGCGGTTGGCGGAAAAACGAGTCTCCGGCGACGGATGTCGCGACATCCGTGGGGTTGTGAAAGACCCTCTTTGTCTTGTCGCGCGAGTCCTCGTCATCTTAGCGAGCTCCAGGACCCATAGGCAGCACACACTCTGGGCGCTTCGACT
Taxonomic Information

Plant ID: NPO15394
Plant Latin Name: Angelica Decursiva
Taxonomy Genus: Angelica
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 52491
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Analgesic; Antiarthritic; Antiseptic; Antispasmodic; Carminative; Expectorant; Lenitive; Stimulant; Stomachic; Tonic

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

101 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


90 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

54 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98179

Ingredient ID: NPC98028

Ingredient ID: NPC93241

Ingredient ID: NPC91226

Ingredient ID: NPC88461

Ingredient ID: NPC86892

Ingredient ID: NPC86412

Ingredient ID: NPC85295

Ingredient ID: NPC78094

Ingredient ID: NPC76753

Ingredient ID: NPC76336

Ingredient ID: NPC7526

Ingredient ID: NPC74539

Ingredient ID: NPC71853

Ingredient ID: NPC63355

Ingredient ID: NPC55615

Ingredient ID: NPC55149

Ingredient ID: NPC49074

Ingredient ID: NPC47163

Ingredient ID: NPC40070

Ingredient ID: NPC37708

Ingredient ID: NPC33320

Ingredient ID: NPC325450

Ingredient ID: NPC323861

Ingredient ID: NPC32095

Ingredient ID: NPC319389

Ingredient ID: NPC312881

Ingredient ID: NPC31194

Ingredient ID: NPC308383

Ingredient ID: NPC306858

Ingredient ID: NPC305007

Ingredient ID: NPC301224

Ingredient ID: NPC301055

Ingredient ID: NPC300274

Ingredient ID: NPC297472

Ingredient ID: NPC296624

Ingredient ID: NPC296377

Ingredient ID: NPC294707

Ingredient ID: NPC294456

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC289785

Ingredient ID: NPC281398

Ingredient ID: NPC281014

Ingredient ID: NPC279325

Ingredient ID: NPC276761

Ingredient ID: NPC267412

Ingredient ID: NPC253574

Ingredient ID: NPC248884

Ingredient ID: NPC247553

Ingredient ID: NPC243728

Ingredient ID: NPC243688

Ingredient ID: NPC24355

Ingredient ID: NPC243546

Ingredient ID: NPC243509

Ingredient ID: NPC234536

Ingredient ID: NPC232548

Ingredient ID: NPC230301

Ingredient ID: NPC230091

Ingredient ID: NPC225804

Ingredient ID: NPC225106

Ingredient ID: NPC224194

Ingredient ID: NPC222843

Ingredient ID: NPC222036

Ingredient ID: NPC218482

Ingredient ID: NPC216630

Ingredient ID: NPC215519

Ingredient ID: NPC215512

Ingredient ID: NPC215179

Ingredient ID: NPC214224

Ingredient ID: NPC212124

Ingredient ID: NPC206490

Ingredient ID: NPC206452

Ingredient ID: NPC204353

Ingredient ID: NPC199658

Ingredient ID: NPC198381

Ingredient ID: NPC195343

Ingredient ID: NPC187145

Ingredient ID: NPC184861

Ingredient ID: NPC183054

Ingredient ID: NPC175941

Ingredient ID: NPC175051

Ingredient ID: NPC169510

Ingredient ID: NPC165967

Ingredient ID: NPC165641

Ingredient ID: NPC164269

Ingredient ID: NPC163533

Ingredient ID: NPC160240

Ingredient ID: NPC156461

Ingredient ID: NPC149209

Ingredient ID: NPC148638

Ingredient ID: NPC139891

Ingredient ID: NPC138460

Ingredient ID: NPC137115

Ingredient ID: NPC135295

Ingredient ID: NPC135073

Ingredient ID: NPC133956

Ingredient ID: NPC128633

Ingredient ID: NPC113733

Ingredient ID: NPC102511

Ingredient ID: NPC100285