• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Paeonia Rockii


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAACCTGCCTAGCAGAACGACCAGCGAACTTGTAAAAATGCTCGGGCTGAGGGAAGGCGTGAGCCTCTCCTTCATCCCACGTCCGATCGCACCAGACGTTGAGTCGCCCCTCGCACGATGTGCAGGGAAGCGCCAAGGTTCTGGTGTGCTCTCGGATTTACAACAAACCCCGGCGCAAACCGCGCCAAGGAACTAAAACGAAAGAGCATGCCCCCGTTGCCCCGACTTTGGGATGCGCGGGAGGTAATGTCTTCTTTTACATATCAAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCCCGTCGCACCCCCAACCCGTCCCAACGCGGGCACGATGGCTGGTGGGAGCGGATATTGGCCTCCCGTGTACTCGCGTCGCGGTTGGTCTAAAATCGAGCCCCGAGCGACGAACGTCACGACAAGTGGTGGTCTGTAATAGCTATTTCGTGTTGTGCGTTGTCTCGTCGCCCGTGTGAGCTCACAAAAACCCCAGAGCATCGTCACGATGATGCTTCCA

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO15265
Plant Latin Name: Paeonia Rockii
Taxonomy Genus: Paeonia
Taxonomy Family: Paeoniaceae

Plant External Links:

NCBI TaxonomyDB: 62886
Plant-of-the-World-Online: 1005939-1

Used in Medicines

Unknown.

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

130 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


79 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

76 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97782

Ingredient ID: NPC97608

Ingredient ID: NPC89534

Ingredient ID: NPC88176

Ingredient ID: NPC85813

Ingredient ID: NPC85346

Ingredient ID: NPC82183

Ingredient ID: NPC81010

Ingredient ID: NPC79943

Ingredient ID: NPC77493

Ingredient ID: NPC77031

Ingredient ID: NPC70744

Ingredient ID: NPC62765

Ingredient ID: NPC57265

Ingredient ID: NPC56594

Ingredient ID: NPC52975

Ingredient ID: NPC52472

Ingredient ID: NPC50898

Ingredient ID: NPC491280

Ingredient ID: NPC491278

Ingredient ID: NPC491248

Ingredient ID: NPC48623

Ingredient ID: NPC477616

Ingredient ID: NPC43783

Ingredient ID: NPC39351

Ingredient ID: NPC36357

Ingredient ID: NPC36275

Ingredient ID: NPC34269

Ingredient ID: NPC34066

Ingredient ID: NPC33772

Ingredient ID: NPC32163

Ingredient ID: NPC31952

Ingredient ID: NPC318107

Ingredient ID: NPC305835

Ingredient ID: NPC302857

Ingredient ID: NPC300326

Ingredient ID: NPC29883

Ingredient ID: NPC297512

Ingredient ID: NPC296747

Ingredient ID: NPC294902

Ingredient ID: NPC294852

Ingredient ID: NPC294548

Ingredient ID: NPC292452

Ingredient ID: NPC288212

Ingredient ID: NPC28657

Ingredient ID: NPC285352

Ingredient ID: NPC283530

Ingredient ID: NPC282895

Ingredient ID: NPC281131

Ingredient ID: NPC280725

Ingredient ID: NPC280652

Ingredient ID: NPC279572

Ingredient ID: NPC279121

Ingredient ID: NPC276444

Ingredient ID: NPC273769

Ingredient ID: NPC270768

Ingredient ID: NPC266689

Ingredient ID: NPC265647

Ingredient ID: NPC264916

Ingredient ID: NPC264317

Ingredient ID: NPC264145

Ingredient ID: NPC264112

Ingredient ID: NPC264005

Ingredient ID: NPC261831

Ingredient ID: NPC259182

Ingredient ID: NPC25018

Ingredient ID: NPC248932

Ingredient ID: NPC246162

Ingredient ID: NPC236202

Ingredient ID: NPC235260

Ingredient ID: NPC230301

Ingredient ID: NPC228626

Ingredient ID: NPC225710

Ingredient ID: NPC225280

Ingredient ID: NPC225175

Ingredient ID: NPC220173

Ingredient ID: NPC219876

Ingredient ID: NPC219431

Ingredient ID: NPC216630

Ingredient ID: NPC209970

Ingredient ID: NPC209846

Ingredient ID: NPC20791

Ingredient ID: NPC206800

Ingredient ID: NPC204914

Ingredient ID: NPC202642

Ingredient ID: NPC195334

Ingredient ID: NPC1946

Ingredient ID: NPC192689

Ingredient ID: NPC192546

Ingredient ID: NPC190862

Ingredient ID: NPC188217

Ingredient ID: NPC187605

Ingredient ID: NPC186098

Ingredient ID: NPC185292

Ingredient ID: NPC179377

Ingredient ID: NPC178383

Ingredient ID: NPC176740

Ingredient ID: NPC168635

Ingredient ID: NPC16512

Ingredient ID: NPC162742

Ingredient ID: NPC161626

Ingredient ID: NPC161617

Ingredient ID: NPC161571

Ingredient ID: NPC161193

Ingredient ID: NPC156432

Ingredient ID: NPC142415

Ingredient ID: NPC141724

Ingredient ID: NPC140921

Ingredient ID: NPC138577

Ingredient ID: NPC133671

Ingredient ID: NPC130520

Ingredient ID: NPC12936

Ingredient ID: NPC12925

Ingredient ID: NPC128610

Ingredient ID: NPC126596

Ingredient ID: NPC125062

Ingredient ID: NPC124010

Ingredient ID: NPC123965

Ingredient ID: NPC121973

Ingredient ID: NPC120012

Ingredient ID: NPC117418

Ingredient ID: NPC116775

Ingredient ID: NPC114891

Ingredient ID: NPC113817

Ingredient ID: NPC112280

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC108811

Ingredient ID: NPC107562

Ingredient ID: NPC100551