• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Rosa Rugosa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GGTATAGCGGAGGAGTGAGTGTAGTGTCGTCACGGGGCTATCAATGCGCAGAAGAAGTGTTTCACGCTTGGGGGCGGAGGGTCTTGCGGCTCTGCGCCCCCTCATCCTAGGAGGCAAGTGTCTTGCGCGTTGCATTTCGGTGCTTGCGCTTGACCGACCCTCCCGGGCGTACTGAACACCGGCGTGAATTGCGCCAAGGAACTTGAATGAAAGAGCGTTTCCCCCGCCGTCCCGGAGACGGTGCTCGTGCGGGTGGTTTCGTCGTCTTCAATATGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACACGTCGTTGCCCCCCCCCACCCTCCTCGGGAGTTGGATGGGACGGATGATGGCCTCCCGTGTGCTCAGTCACGCGGTTGGCATAAATACCAAGTCCTCGGCGACCAACGCCACGACAATCGGTGGTTGTCAAACCTCGGTTGCCTGTCGTGCGCGCGTCTTGATCGAGCCTTTCGTGGACAATGTGGGTCGAACTGTCGCACGTCACCCACTCAGCGCAGACATGAGAAAATAACTTC

Click for details-----ITS1

GGTATAGCGGAGGAGTGAGTGTAGTGTCGTCACGGGGCTATCAATGCGCAGAAGAAGTGTTTCACGCTTGGGGGCGGAGGGTCTTGCGGCTCTGCGCCCCCTCATCCTAGGAGGCAAGTGTCTTGCGCGTTGCATTTCGGTGCTTGCGCTTGACCGACCCTCCCGGGCGTACTGAACACCGGCGTGAATTGCGCCAAGGAACTTGAATGAAAGAGCGTTTCCCCCGCCGTCCCGGAGACGGTGCTCGTGCGGGTGGTTTCGTCGTCTTCAATATGTCTAAA

Click for details-----ITS2

GTCGTTGCCCCCCCCCACCCTCCTCGGGAGTTGGATGGGACGGATGATGGCCTCCCGTGTGCTCAGTCACGCGGTTGGCATAAATACCAAGTCCTCGGCGACCAACGCCACGACAATCGGTGGTTGTCAAACCTCGGTTGCCTGTCGTGCGCGCGTCTTGATCGAGCCTTTCGTGGACAATGTGGGTCGAACTGTCGCACGTCACCCACTCAGCGCAGACATGAGAAAATAACTTC
Taxonomic Information

Plant ID: NPO1524
Plant Latin Name: Rosa Rugosa
Taxonomy Genus: Rosa
Taxonomy Family: Rosaceae

Plant External Links:

NCBI TaxonomyDB: 74645
Plant-of-the-World-Online: 927373-1

Used in Medicines

Country/Region:
Finland; China

Traditional Medicine System:
TCM


Medicinal Functions:

Cancer; Hepatic

Geographical Distribution

Canada; Ukraine; Belarus; Italy; South Africa; Denmark; Poland; Finland; France; United Kingdom; Switzerland; Sweden; Netherlands; China; Ireland; Japan; Belgium; Germany; Norway; Russia; United States

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

168 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


71 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

89 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC94901

Ingredient ID: NPC94610

Ingredient ID: NPC94149

Ingredient ID: NPC89105

Ingredient ID: NPC85473

Ingredient ID: NPC83268

Ingredient ID: NPC83032

Ingredient ID: NPC82917

Ingredient ID: NPC82123

Ingredient ID: NPC81010

Ingredient ID: NPC73517

Ingredient ID: NPC70409

Ingredient ID: NPC69938

Ingredient ID: NPC68492

Ingredient ID: NPC67037

Ingredient ID: NPC5947

Ingredient ID: NPC59013

Ingredient ID: NPC58890

Ingredient ID: NPC58616

Ingredient ID: NPC58190

Ingredient ID: NPC56506

Ingredient ID: NPC56253

Ingredient ID: NPC51700

Ingredient ID: NPC50898

Ingredient ID: NPC48191

Ingredient ID: NPC47946

Ingredient ID: NPC47521

Ingredient ID: NPC471756

Ingredient ID: NPC471755

Ingredient ID: NPC471391

Ingredient ID: NPC471390

Ingredient ID: NPC471389

Ingredient ID: NPC471388

Ingredient ID: NPC39360

Ingredient ID: NPC38408

Ingredient ID: NPC37477

Ingredient ID: NPC32977

Ingredient ID: NPC32877

Ingredient ID: NPC316929

Ingredient ID: NPC312800

Ingredient ID: NPC308501

Ingredient ID: NPC305795

Ingredient ID: NPC304505

Ingredient ID: NPC302857

Ingredient ID: NPC301898

Ingredient ID: NPC29883

Ingredient ID: NPC298381

Ingredient ID: NPC298257

Ingredient ID: NPC298120

Ingredient ID: NPC296256

Ingredient ID: NPC295990

Ingredient ID: NPC295036

Ingredient ID: NPC294902

Ingredient ID: NPC294613

Ingredient ID: NPC292792

Ingredient ID: NPC291957

Ingredient ID: NPC281131

Ingredient ID: NPC275569

Ingredient ID: NPC274717

Ingredient ID: NPC268868

Ingredient ID: NPC267979

Ingredient ID: NPC26628

Ingredient ID: NPC265885

Ingredient ID: NPC265379

Ingredient ID: NPC265184

Ingredient ID: NPC264317

Ingredient ID: NPC261411

Ingredient ID: NPC258561

Ingredient ID: NPC258331

Ingredient ID: NPC257124

Ingredient ID: NPC25701

Ingredient ID: NPC256186

Ingredient ID: NPC256

Ingredient ID: NPC255615

Ingredient ID: NPC253507

Ingredient ID: NPC251791

Ingredient ID: NPC250436

Ingredient ID: NPC248589

Ingredient ID: NPC248296

Ingredient ID: NPC24824

Ingredient ID: NPC239931

Ingredient ID: NPC238547

Ingredient ID: NPC23837

Ingredient ID: NPC235059

Ingredient ID: NPC229827

Ingredient ID: NPC226490

Ingredient ID: NPC225710

Ingredient ID: NPC222781

Ingredient ID: NPC219876

Ingredient ID: NPC219380

Ingredient ID: NPC217423

Ingredient ID: NPC216092

Ingredient ID: NPC215484

Ingredient ID: NPC214208

Ingredient ID: NPC21180

Ingredient ID: NPC210003

Ingredient ID: NPC20791

Ingredient ID: NPC206807

Ingredient ID: NPC204770

Ingredient ID: NPC2003

Ingredient ID: NPC200209

Ingredient ID: NPC198658

Ingredient ID: NPC197396

Ingredient ID: NPC197316

Ingredient ID: NPC196434

Ingredient ID: NPC195807

Ingredient ID: NPC194196

Ingredient ID: NPC193350

Ingredient ID: NPC19240

Ingredient ID: NPC190204

Ingredient ID: NPC188907

Ingredient ID: NPC185340

Ingredient ID: NPC185044

Ingredient ID: NPC182840

Ingredient ID: NPC182602

Ingredient ID: NPC181465

Ingredient ID: NPC179950

Ingredient ID: NPC178638

Ingredient ID: NPC178134

Ingredient ID: NPC176740

Ingredient ID: NPC175468

Ingredient ID: NPC173637

Ingredient ID: NPC173582

Ingredient ID: NPC170484

Ingredient ID: NPC168623

Ingredient ID: NPC167976

Ingredient ID: NPC167872

Ingredient ID: NPC166829

Ingredient ID: NPC165651

Ingredient ID: NPC164400

Ingredient ID: NPC160596

Ingredient ID: NPC160512

Ingredient ID: NPC159913

Ingredient ID: NPC158537

Ingredient ID: NPC158214

Ingredient ID: NPC157113

Ingredient ID: NPC156654

Ingredient ID: NPC154477

Ingredient ID: NPC152185

Ingredient ID: NPC149377

Ingredient ID: NPC14930

Ingredient ID: NPC147232

Ingredient ID: NPC14209

Ingredient ID: NPC139144

Ingredient ID: NPC135846

Ingredient ID: NPC133671

Ingredient ID: NPC129264

Ingredient ID: NPC127429

Ingredient ID: NPC126106

Ingredient ID: NPC126029

Ingredient ID: NPC125984

Ingredient ID: NPC124530

Ingredient ID: NPC122071

Ingredient ID: NPC121372

Ingredient ID: NPC11908

Ingredient ID: NPC119010

Ingredient ID: NPC118343

Ingredient ID: NPC116775

Ingredient ID: NPC115723

Ingredient ID: NPC114697

Ingredient ID: NPC113434

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC108218

Ingredient ID: NPC1075

Ingredient ID: NPC102449

Ingredient ID: NPC100551

Ingredient ID: NPC100515