CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Eichhornia Crassipes

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCATGCAGAACGACCGCGAACATGTTTTATGTTTGGAGGAAAGCGGATCCATTTGGCTCTGTCCCGACTCCTTGCGTCGGTTAACGTCCCCTGTGGATGTTGGCCAATGCATGTAACAAATCCCMGCGCGGAATGCGCCAAGGAATATGAATMMTTGTGAGTCCATGCGCTCYCGGTTTTGCCSGGARTTGCATGCGGCACCTAATCAAGGAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAGCCATCGAGTCTTTGAACGCAAGTTGCCCCCGATGCCACTAGGCTGAAGGCACGTTTGCCTGGGGGTCACCCACAGCATCTCCCCATCCCTCCTCCTTTGWGAGGTAGGGGAAGGATGATGACCTCCTGTGCCCCTAGTCGGGTGTTGTTGGTCTAAATAGGGGGCCCTCGGTGATGAGTTGCGGCAATAGTTGGTTAACAAGGCCTTTGTCCGCGTTTCATTTTGTTGTCCGAGCAAATTGCTGATTAGGGCTCGCACGWCCCTGTACTTTTAATGTTGCGACCCCAGGTCAGGCGGGATTAC

Click for details-----ITS1

Click for details-----ITS2

ACAGCATCTCCCCATCCCTCCTCCTTTGWGAGGTAGGGGAAGGATGATGACCTCCTGTGCCCCTAGTCGGGTGTTGTTGGTCTAAATAGGGGGCCCTCGGTGATGAGTTGCGGCAATAGTTGGTTAACAAGGCCTTTGTCCGCGTTTCATTTTGTTGTCCGAGCAAATTGCTGATTAGGGCTCGCACGWCCCTGTACTTTTAATGTTGCGACCCCAGGTCAGGCGGGATTAC

Taxonomic Information

Plant ID: NPO15167
Plant Latin Name: Eichhornia Crassipes
Taxonomy Genus: Eichhornia
Taxonomy Family: Pontederiaceae

Plant External Links:

NCBI TaxonomyDB: 44947
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

Thailand; Indonesia; India; China

Traditional Medicine System:

TCM; Ayurveda; Siddha

Geographical Distribution

India; Indonesia; China; Thailand

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

37 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

33 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

22 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC96655

Ingredient ID: NPC96294

Ingredient ID: NPC83546

Ingredient ID: NPC76336

Ingredient ID: NPC75154

Ingredient ID: NPC57516

Ingredient ID: NPC52086

Ingredient ID: NPC50898

Ingredient ID: NPC49074

Ingredient ID: NPC48366

Ingredient ID: NPC434

Ingredient ID: NPC306470

Ingredient ID: NPC29883

Ingredient ID: NPC294555

Ingredient ID: NPC282378

Ingredient ID: NPC279121

Ingredient ID: NPC269451

Ingredient ID: NPC266590

Ingredient ID: NPC247553

Ingredient ID: NPC243728

Ingredient ID: NPC231772

Ingredient ID: NPC230530

Ingredient ID: NPC230301

Ingredient ID: NPC205853

Ingredient ID: NPC205727

Ingredient ID: NPC203891

Ingredient ID: NPC183950

Ingredient ID: NPC180023

Ingredient ID: NPC1786

Ingredient ID: NPC158069

Ingredient ID: NPC148835

Ingredient ID: NPC141765

Ingredient ID: NPC137260

Ingredient ID: NPC136702

Ingredient ID: NPC120464

Ingredient ID: NPC105772

Ingredient ID: NPC100039

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Therapeutic Target	Enzyme	NOX4	NADPH oxidase 4	Q9NPH5	CHEMBL1250375
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Lyase	CA4	Carbonic anhydrase IV	P22748	CHEMBL3729
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326
Therapeutic Target	Lyase	CA9	Carbonic anhydrase IX	Q16790	CHEMBL3594
Therapeutic Target	Metallo protease	MMP12	Matrix metalloproteinase 12	P39900	CHEMBL4393
Therapeutic Target	Nuclear hormone receptor subfamily 3	ESR2	Estrogen receptor beta	Q92731	CHEMBL242
Therapeutic Target	Oxidoreductase	MAOB	Monoamine oxidase B	P27338	CHEMBL2039
Therapeutic Target	Oxidoreductase	HSD17B1	Estradiol 17-beta-dehydrogenase 1	P14061	CHEMBL3181
Therapeutic Target	Oxidoreductase	MAOA	Monoamine oxidase A	P21397	CHEMBL1951
Therapeutic Target	Protein Kinase	CDK8	Cell division protein kinase 8	P49336	CHEMBL5719
Therapeutic Target	Protein Kinase	CSNK2A1	Casein kinase II alpha	P68400	CHEMBL3629
Therapeutic Target	Protein Kinase	MKNK2	MAP kinase signal-integrating kinase 2	Q9HBH9	CHEMBL4204
Therapeutic Target	Protein Kinase	MKNK1	MAP kinase-interacting serine/threonine-protein kinase MNK1	Q9BUB5	CHEMBL4718
Therapeutic Target	Protein Kinase	FLT3	Tyrosine-protein kinase receptor FLT3	P36888	CHEMBL1974
Therapeutic Target	Secreted protein	TTR	Transthyretin	P02766	CHEMBL3194
Therapeutic Target	Secreted protein	THPO	Thrombopoietin	P40225	CHEMBL1293256
Therapeutic Target	Serine protease	DPP4	Dipeptidyl peptidase IV	P27487	CHEMBL284
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD1	Dopamine D1 receptor	P21728	CHEMBL2056
Therapeutic Target	Transcription factor	HIF1A	Hypoxia-inducible factor 1 alpha	Q16665	CHEMBL4261

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CA12,CSNK2A1,CSNK2A3,CA9,MMP12,PSMB5,NOX4,CYP1A2,XDH
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	HIF1A,CSNK2A1,CSNK2A3,CA4,CA9,ESR2,MMP12,NOX4,AKR1B1
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	FLT3,DPP4,XDH,CSNK2A2,CA9,MMP12,CA12,DRD1,CA7
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA12,F2,XDH,CA9,MMP12,ACHE,CA7,TTR,THPO
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	FLT3,DPP4,CA9,MMP12,ACHE,CYP1B1,PSMB5,DRD1,AKR1B1
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	DPP4,CA7,CA9,MMP12,PSMB5,CYP19A1,AKR1B1,XDH
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CA12,DPP4,CA4,CA9,MMP12,NOX4,CYP19A1,CA7
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CYP19A1,CA12,CA4,MKNK2,ESR2,CA9,MKNK1
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	CYP19A1,CA9,ACHE,XDH,F2,CA9,MMP12
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA12,F2,CA9,MMP12,HSD17B1,CA7,XDH
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	DPP4,MMP12,CYP1B1,NOX4,CA12,CA7,XDH
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	XDH,CA4,MMP12,ACHE,NOX4,TTR
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CYP19A1,CA12,CA4,MMP12,NOX4,AKR1B1
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	ESR2,ACHE,KDM4E,CYP2C19,CYP1A1,THPO
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA12,DPP4,CSNK2A3,CA9,CYP1B1,CYP19A1
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	ESR2,ACHE,MAOB,FLT3,MAOA
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	GSK3B,MAOA,ACHE,MAOB,DRD1
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	FLT3,DPP4,MMP12,NOX4,AKR1B1
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	F2,MMP12,NOX4,CYP19A1,DRD1
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	F2,CA9,MMP12,NOX4,CYP1A1
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA9,MMP12,HSD17B1,CA12,XDH
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CA9,HSD17B1,CYP1A2,AKR1B1,TTR
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	F2,CA9,MMP12,XDH,CYP1A1
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	MKNK1,HIF1A,CA9,MKNK2
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	F2,CA9,MMP12,NOX4
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	ACHE,HSD17B1,DPP4,CA4
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CA9,MMP12,CA12,THPO
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA12,CYP1A2,TTR,CYP1A1
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	DPP4,CYP1B1,NOX4,THPO
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	FLT3,CDK8,GSK3B
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	MKNK1,FLT3,MKNK2
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE,DRD1,MAOB
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	MAOB,MAOA,ESR2
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	MAOB,DRD1,HIF1A
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	MKNK2,CSNK2A1,MKNK1
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	AKR1B1,ACHE,CA4
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	CA4,MMP12,F2
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	DPP4,THPO,F2
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	FLT3,DPP4 MMP12
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	CYP19A1,ACHE,DPP4
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	MMP12,ACHE,NOX4
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	MMP12,CYP1A1,CA9
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	CYP19A1,XDH,HIF1A
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ACHE,AKR1B1
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	MMP12,CA9
General pain disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E43	MAOA,MAOB
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	THPO,F2
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	MAOB,MAOA
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	DPP4,F2
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA4,CA12
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	AKR1B1,F2
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA12,CA4
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	CYP19A1,AKR1B1
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	MAOA,ACHE
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	MAOB,MAOA
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	AKR1B1,DRD1
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	DPP4,AKR1B1
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	MMP12,FLT3
Skin tag/polyp Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK71	MAOB,MAOA
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	ESR2,CYP19A1
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	FLT3,GSK3B
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	DPP4,FLT3
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	NOX4,MMP12
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F2,CA4
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	NOX4,TTR
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	MMP12,DPP4
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	NOX4,TTR
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ACHE,CYP1A1
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	MMP12,CDK8
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	MMP12,NOX4
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	CSNK2A1,CA12,CDK8,CSNK2A2,CA9,NOX4,MAOB,ESR2,ACHE,AKR1B1,PSMB5,THPO
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	F2,DPP4,XDH,CA9,MAOB,ACHE,CYP1B1,HIF1A,DRD1,CA7,TTR,CYP2C19
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CA12,F2,HIF1A,DPP4,XDH,CA4,ACHE,NOX4,DRD1,AKR1B1,TTR
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	XDH,CA4,FLT3,HIF1A,MKNK2,CA9,MKNK1,GSK3B,CSNK2A1,CA12
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CYP19A1,CA12,CA4,CA9,MMP12,NOX4,CYP19A1,CA12,CA9,MMP12
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	F2
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	ESR2
Myotonic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71	GSK3B
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Encephalopathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E47	XDH
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	F2
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	FLT3
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	DPP4
Amyloidosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5D00	TTR
Cardiomyopathy Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC43	TTR
Chronic myelomonocytic leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A40	FLT3
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	FLT3
Fragile X chromosome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD55	GSK3B
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	F2
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	CYP19A1
Hepatitis virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50-1E51	ESR2
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F2
Mastocytosis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A21	FLT3
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Inflammatory arthropathy Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA2Z	FLT3
Gout Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA25	XDH
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	DPP4
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	DPP4
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	FLT3
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Nausea/vomiting Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD90	MAOB
Sepsis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G40-1G41	ESR2
NA Disease Category: NA Disease ICD-11 Code: NA	NOX4
Cataract Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B10	AKR1B1
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	FLT3
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	FLT3
Migraine Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A80	MAOB
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	F2
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	CYP19A1
Influenza Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E30-1E32	XDH
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	FLT3
Prostate hyperplasia Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA90	ESR2
Phakomatoses/hamartoneoplastic syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2D	FLT3
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	DRD1
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	FLT3
Inborn purine/pyrimidine/nucleotide metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C55	XDH
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	MAOB
Bone/articular cartilage neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F7B	FLT3
Adrenomedullary hyperfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A75	HIF1A
Malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F40-1F45	MAOB
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	ESR2
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	XDH
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	FLT3
Skin cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30-2C37	MAOB
Tic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A05	DRD1
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F2
Transplanted organ/tissue Disease Category: 24.Factors influencing health status or contact with health services Disease ICD-11 Code: QB63	FLT3
Abortion Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA00	DRD1
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	CDK8
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	XDH
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	DPP4
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F2
Mood disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60-6E23	MAOA
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Vasomotor/allergic rhinitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA08	ESR2
Primary psychotic disorder manifestation Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A25	MAOB
Allergic/hypersensitivity disorder Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A80-4A8Z	DRD1
Human immunodeficiency virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C60-1C62	FLT3
Cocaine use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C45	DRD1
Unspecified viral infection of unspecified site Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D9Z	FLT3
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	HIF1A
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	AKR1B1
Osteosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B51	GSK3B
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Mineral deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B5K	XDH
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	F2
Menopausal disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA30	ESR2
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	MMP12
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CYP1A1
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	MAOA
Idiopathic pulmonary fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03.4	MMP12
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	CYP1A1
Keratoconus Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A78.50	CA4
Pre-eclampsia Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA24	CA4
Systemic sclerosis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A42	NOX4
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CYP1B1
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	FLT3
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Eichhornia Crassipes

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

37 All known Ingredients in Total

33 Ingredients with Acceptable Bioavailablity

22 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Serous cystadenoma,borderline malignancy of ovary

Malignant neoplasms of biliary tract, distal bile duct

Mesothelioma of pleura

Adenocarcinoma of bronchus or lung

Malignant neoplasms of thymus

Carcinosarcoma of uterus

Malignant neoplasms of adrenal gland

Breast cancer

Other specified malignant neoplasms of kidney, except renal pelvis

Squamous cell carcinoma of bronchus or lung

Malignant neoplasms of thyroid gland, unspecified

Pheochromocytoma

Hepatoblastoma

Cytomegaloviral disease

Glioblastoma of brain

Alzheimer disease

Parkinsonism

Leishmaniasis

Adenocarcinoma of stomach

Other specified malignant neoplasms ofcolon

Other specified malignant neoplasms of bronchus or lung

Urothelial carcinoma of bladder

Malignant neoplasms of corpus uteri, unspecified

Mature T-cell lymphoma

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Superficial ovarian endometriosis

Invasive carcinoma of breast

Renal cell carcinoma, chromophobe type

Carpal tunnel syndrome

Acute myeloid leukaemia

Colorectal cancer

Dementia

Prostate cancer

Pulmonary hypertension

Liver cancer

Glaucoma

Asthma

Myocardial infarction

Psoriasis

West Nile virus infection

Malignant neoplasms of oesophagus

Chronic rhinosinusitis

Chikungunya virus disease

Pain, unspecified

Renal cell carcinoma

General pain disorder

Ischaemic/haemorrhagic stroke

Depression

Type 2 diabetes mellitus

Bacterial infection

Thrombosis

Seborrhoeic dermatitis

Neuropathy

Substance abuse

Acquired hypomelanotic disorder

Schizophrenia

Acute diabete complication

Lung cancer

Skin tag/polyp

Cushing syndrome

Myeloproliferative neoplasm

Malignant haematopoietic neoplasm