• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Cephalotaxus Hainanensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

CTGGTTCCTATCCATGAACTGTGTAGGGGAGGTGGCACATGCAGCTCTGTCGAGCACCTCGCCTCCCTGCCCCCCACTCTCTCTAGCATCAGGATCAAAGCCCTCCTAGGAGGTTGGTCGTACTGCGGCAGACCCCAAGCCATCTCTACCTCCCTCGGCTCTAGTTTGAGGTAATAATTTAGGGGTGCATTTGAGTGTCATCTCCTCATGGTGAAGCGATGTAGGGTGCTAGTTTCTAATGGCAATAGGTGCACCTGTCGACTGGGGTAGTCTTGGCCTTGTTGTTATCCAGACTGGCCAAGTCACTTCCCTTCAAGGGTCAATTCCTCGAGAGCACTCACAGCATCATGCATGGTCTCACCTTTTTGATATGGACTGCAAGGCATAGCTACAACCCACCTTTGCATCTTTAGATGTTGTGGGGTGGGGACACCGCCCATTCTACGATACCTCCTATGAGGCTTCTTAGCATCTAGGCCCCGGTGGGGCAATCATGGGATGGGGCATGTGTCACAAACACTTAGCCTGTTGGTACAACTCATGTCAATGAATGAAAGGATAGTTGCACGAGACTCACACCATGTGTGTGTCAGATCCTCGGCCTAATGTGAACA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO15166
Plant Latin Name: Cephalotaxus Hainanensis
Taxonomy Genus: Cephalotaxus
Taxonomy Family: Taxaceae

Plant External Links:

NCBI TaxonomyDB: 191701
Plant-of-the-World-Online: 828269-1

Used in Medicines

Unknown.

Geographical Distribution

Thailand; Vietnam; China; Myanmar

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

91 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


76 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

20 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC94048

Ingredient ID: NPC9224

Ingredient ID: NPC90273

Ingredient ID: NPC80043

Ingredient ID: NPC75279

Ingredient ID: NPC72349

Ingredient ID: NPC71417

Ingredient ID: NPC69394

Ingredient ID: NPC68926

Ingredient ID: NPC68556

Ingredient ID: NPC67246

Ingredient ID: NPC66823

Ingredient ID: NPC6667

Ingredient ID: NPC60857

Ingredient ID: NPC60779

Ingredient ID: NPC56457

Ingredient ID: NPC52912

Ingredient ID: NPC47452

Ingredient ID: NPC42477

Ingredient ID: NPC41020

Ingredient ID: NPC38749

Ingredient ID: NPC327716

Ingredient ID: NPC327158

Ingredient ID: NPC325967

Ingredient ID: NPC325924

Ingredient ID: NPC325693

Ingredient ID: NPC324846

Ingredient ID: NPC319549

Ingredient ID: NPC31206

Ingredient ID: NPC310674

Ingredient ID: NPC306420

Ingredient ID: NPC304341

Ingredient ID: NPC303672

Ingredient ID: NPC303015

Ingredient ID: NPC300455

Ingredient ID: NPC297249

Ingredient ID: NPC292199

Ingredient ID: NPC282405

Ingredient ID: NPC27765

Ingredient ID: NPC273023

Ingredient ID: NPC271540

Ingredient ID: NPC268808

Ingredient ID: NPC268298

Ingredient ID: NPC268151

Ingredient ID: NPC26062

Ingredient ID: NPC252791

Ingredient ID: NPC24631

Ingredient ID: NPC243728

Ingredient ID: NPC241517

Ingredient ID: NPC238870

Ingredient ID: NPC236166

Ingredient ID: NPC234096

Ingredient ID: NPC230301

Ingredient ID: NPC216432

Ingredient ID: NPC213329

Ingredient ID: NPC210545

Ingredient ID: NPC206660

Ingredient ID: NPC201969

Ingredient ID: NPC200651

Ingredient ID: NPC195736

Ingredient ID: NPC19176

Ingredient ID: NPC190955

Ingredient ID: NPC186830

Ingredient ID: NPC184289

Ingredient ID: NPC178613

Ingredient ID: NPC171928

Ingredient ID: NPC1699

Ingredient ID: NPC167028

Ingredient ID: NPC166970

Ingredient ID: NPC166487

Ingredient ID: NPC16647

Ingredient ID: NPC162276

Ingredient ID: NPC152804

Ingredient ID: NPC152472

Ingredient ID: NPC142229

Ingredient ID: NPC13830

Ingredient ID: NPC134696

Ingredient ID: NPC134337

Ingredient ID: NPC133704

Ingredient ID: NPC129396

Ingredient ID: NPC120365

Ingredient ID: NPC120203

Ingredient ID: NPC118057

Ingredient ID: NPC115394

Ingredient ID: NPC115383

Ingredient ID: NPC11466

Ingredient ID: NPC113974

Ingredient ID: NPC1077

Ingredient ID: NPC104942

Ingredient ID: NPC103972

Ingredient ID: NPC101582