• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Hippophae Rhamnoides


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCATGCAGAACAACCCGCGAACTAGTTTAAAAATAGGGGATGATCTATCCTCNAGGATACGATTATTACCCATTGTTAGTTGCAATGTTGTTTGTGCTTGCACCTTTTCTATGTGAAAGTGGTAAGTATGATGACATTTTCCTGGCAAAAATAACTAACCCACGGCGCAGATCGCGCCAAGGAACTCGAACGAAAGAGCGTGCNCTCCTTGGCCCGGATATGGTGTCCTTGTGAGGGTTACGTTGTCTTCGATATGTAAAAAANGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCTGAGGGCACGTCTGCCTGGGCGTCACACACCGTTGCCCTCCCAACATCACGTTCCTTCAAGGCTACGTTGGTTGTGAAGGCGCATATTGGCTTCCCGTGAGCTTTGCCTTGTGGTTGGCCCAAATTTTTAGTCATTGGCGACCTGTGCCGCGACAATGGTGGTTGTCGAAACTTCGGTGCCCTGTCGTGTGTGCGGGTTGTTCGTGATACAAGGACCCAACGCATTCAATGTGATGCCTCTTGATGCGACCCCAGGTCAGGCGGGGNNACCCTCNAAAGGGGTTCNAAA

Click for details-----ITS1

CGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCATGCAGAACAACCCGTGAACTAGTTTAAAAATAGGTGATGATCTGTTCTCAAGGACATGATTATTACCCATTGTTAGTTGGAATGTTGTTTGTGCTTGCACCTTTTCTATGTGAAAGTGGTAATCATGTTGACATTTCCCTGGCAAAAATAACTAACCAACGGCGCAGATCGCGCCAAGGAACTCTAACGAAAGAGCGTGCTCTCCTTGGCCCTGATATGGTGTCCTTGTGAGGGTTACGTTGTCTTCGATACGTAAAAAA

Click for details-----ITS2

ACCGGTGCCCTCCCAACATCAYGTTCCTTCAAGGCTACGTTGGTTGTGAAGGCGCATATTGGCTTCCCGTGAGCTTTGCCTTGTGGTTGGCCCAAATTTTTAGTCATTGGCGACCAGTGCCGCGACAATGGTGGTAGTTGAAACTTCGGTGCCCTGTCGTGTGTGCGGGTTGTTCGTGATACAAGGACCCAAAGCATTCAATGTGATGCCTCTTGATGAGACCCCAGGTCAGGCGGGAGTA
Taxonomic Information

Plant ID: NPO15095
Plant Latin Name: Hippophae Rhamnoides
Taxonomy Genus: Hippophae
Taxonomy Family: Elaeagnaceae

Plant External Links:

NCBI TaxonomyDB: 193516
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; Finland; India; Russia

Traditional Medicine System:
Indian Folk; TCM


Medicinal Functions:

Astringent; Cancer; Cardiac; Poultice; Tonic; Vermifuge

Geographical Distribution

India; Finland; China; Russia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

310 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


191 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

136 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99088

Ingredient ID: NPC98656

Ingredient ID: NPC98307

Ingredient ID: NPC97444

Ingredient ID: NPC94167

Ingredient ID: NPC94165

Ingredient ID: NPC88789

Ingredient ID: NPC87571

Ingredient ID: NPC87237

Ingredient ID: NPC86655

Ingredient ID: NPC85813

Ingredient ID: NPC85346

Ingredient ID: NPC836

Ingredient ID: NPC83157

Ingredient ID: NPC81010

Ingredient ID: NPC80237

Ingredient ID: NPC80234

Ingredient ID: NPC80064

Ingredient ID: NPC78500

Ingredient ID: NPC7813

Ingredient ID: NPC77272

Ingredient ID: NPC76529

Ingredient ID: NPC76145

Ingredient ID: NPC75279

Ingredient ID: NPC72240

Ingredient ID: NPC70756

Ingredient ID: NPC70744

Ingredient ID: NPC68271

Ingredient ID: NPC68016

Ingredient ID: NPC67552

Ingredient ID: NPC65897

Ingredient ID: NPC64676

Ingredient ID: NPC64434

Ingredient ID: NPC64433

Ingredient ID: NPC63400

Ingredient ID: NPC62188

Ingredient ID: NPC61966

Ingredient ID: NPC61477

Ingredient ID: NPC59712

Ingredient ID: NPC57338

Ingredient ID: NPC57267

Ingredient ID: NPC56432

Ingredient ID: NPC54733

Ingredient ID: NPC5447

Ingredient ID: NPC5339

Ingredient ID: NPC49151

Ingredient ID: NPC490283

Ingredient ID: NPC490280

Ingredient ID: NPC489879

Ingredient ID: NPC48853

Ingredient ID: NPC47993

Ingredient ID: NPC46801

Ingredient ID: NPC45782

Ingredient ID: NPC44037

Ingredient ID: NPC43371

Ingredient ID: NPC424

Ingredient ID: NPC39114

Ingredient ID: NPC38497

Ingredient ID: NPC36409

Ingredient ID: NPC36061

Ingredient ID: NPC35565

Ingredient ID: NPC35561

Ingredient ID: NPC35036

Ingredient ID: NPC34764

Ingredient ID: NPC34092

Ingredient ID: NPC3357

Ingredient ID: NPC32977

Ingredient ID: NPC328788

Ingredient ID: NPC328447

Ingredient ID: NPC325748

Ingredient ID: NPC325585

Ingredient ID: NPC324601

Ingredient ID: NPC323434

Ingredient ID: NPC32306

Ingredient ID: NPC32279

Ingredient ID: NPC322600

Ingredient ID: NPC321819

Ingredient ID: NPC317769

Ingredient ID: NPC317291

Ingredient ID: NPC316926

Ingredient ID: NPC316518

Ingredient ID: NPC315603

Ingredient ID: NPC315459

Ingredient ID: NPC313179

Ingredient ID: NPC313059

Ingredient ID: NPC310912

Ingredient ID: NPC30992

Ingredient ID: NPC307034

Ingredient ID: NPC306813

Ingredient ID: NPC304309

Ingredient ID: NPC302857

Ingredient ID: NPC302637

Ingredient ID: NPC301950

Ingredient ID: NPC301696

Ingredient ID: NPC301585

Ingredient ID: NPC300956

Ingredient ID: NPC29883

Ingredient ID: NPC294902

Ingredient ID: NPC294815

Ingredient ID: NPC294548

Ingredient ID: NPC294134

Ingredient ID: NPC293894

Ingredient ID: NPC293378

Ingredient ID: NPC291886

Ingredient ID: NPC291389

Ingredient ID: NPC290613

Ingredient ID: NPC290598

Ingredient ID: NPC29

Ingredient ID: NPC289758

Ingredient ID: NPC287433

Ingredient ID: NPC287052

Ingredient ID: NPC285363

Ingredient ID: NPC283563

Ingredient ID: NPC281972

Ingredient ID: NPC281457

Ingredient ID: NPC281215

Ingredient ID: NPC281131

Ingredient ID: NPC281128

Ingredient ID: NPC280717

Ingredient ID: NPC279026

Ingredient ID: NPC2785

Ingredient ID: NPC277704

Ingredient ID: NPC277385

Ingredient ID: NPC276584

Ingredient ID: NPC275462

Ingredient ID: NPC273997

Ingredient ID: NPC272085

Ingredient ID: NPC271763

Ingredient ID: NPC270778

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC26536

Ingredient ID: NPC263767

Ingredient ID: NPC261931

Ingredient ID: NPC261831

Ingredient ID: NPC261619

Ingredient ID: NPC257885

Ingredient ID: NPC256186

Ingredient ID: NPC256163

Ingredient ID: NPC254509

Ingredient ID: NPC252433

Ingredient ID: NPC250069

Ingredient ID: NPC249912

Ingredient ID: NPC249045

Ingredient ID: NPC248056

Ingredient ID: NPC24751

Ingredient ID: NPC245989

Ingredient ID: NPC245179

Ingredient ID: NPC243898

Ingredient ID: NPC242203

Ingredient ID: NPC240779

Ingredient ID: NPC238254

Ingredient ID: NPC237593

Ingredient ID: NPC237532

Ingredient ID: NPC236709

Ingredient ID: NPC236598

Ingredient ID: NPC233567

Ingredient ID: NPC232440

Ingredient ID: NPC230881

Ingredient ID: NPC230301

Ingredient ID: NPC228024

Ingredient ID: NPC226087

Ingredient ID: NPC225710

Ingredient ID: NPC225579

Ingredient ID: NPC225434

Ingredient ID: NPC224329

Ingredient ID: NPC223455

Ingredient ID: NPC222696

Ingredient ID: NPC221268

Ingredient ID: NPC22098

Ingredient ID: NPC220889

Ingredient ID: NPC220765

Ingredient ID: NPC219876

Ingredient ID: NPC218109

Ingredient ID: NPC216630

Ingredient ID: NPC215173

Ingredient ID: NPC21374

Ingredient ID: NPC211913

Ingredient ID: NPC21180

Ingredient ID: NPC211753

Ingredient ID: NPC211546

Ingredient ID: NPC211189

Ingredient ID: NPC21038

Ingredient ID: NPC209970

Ingredient ID: NPC208620

Ingredient ID: NPC20791

Ingredient ID: NPC207326

Ingredient ID: NPC206047

Ingredient ID: NPC205003

Ingredient ID: NPC204272

Ingredient ID: NPC203863

Ingredient ID: NPC201844

Ingredient ID: NPC199024

Ingredient ID: NPC198658

Ingredient ID: NPC198215

Ingredient ID: NPC196924

Ingredient ID: NPC196776

Ingredient ID: NPC19607

Ingredient ID: NPC194313

Ingredient ID: NPC192995

Ingredient ID: NPC192402

Ingredient ID: NPC192173

Ingredient ID: NPC190810

Ingredient ID: NPC190742

Ingredient ID: NPC190515

Ingredient ID: NPC19044

Ingredient ID: NPC189883

Ingredient ID: NPC187770

Ingredient ID: NPC187738

Ingredient ID: NPC187546

Ingredient ID: NPC187347

Ingredient ID: NPC186653

Ingredient ID: NPC185785

Ingredient ID: NPC181951

Ingredient ID: NPC181153

Ingredient ID: NPC179950

Ingredient ID: NPC179843

Ingredient ID: NPC179831

Ingredient ID: NPC179787

Ingredient ID: NPC178643

Ingredient ID: NPC178134

Ingredient ID: NPC17810

Ingredient ID: NPC177996

Ingredient ID: NPC176740

Ingredient ID: NPC175899

Ingredient ID: NPC175342

Ingredient ID: NPC174213

Ingredient ID: NPC173648

Ingredient ID: NPC173208

Ingredient ID: NPC171148

Ingredient ID: NPC169786

Ingredient ID: NPC169749

Ingredient ID: NPC169407

Ingredient ID: NPC16656

Ingredient ID: NPC166249

Ingredient ID: NPC165620

Ingredient ID: NPC164700

Ingredient ID: NPC163115

Ingredient ID: NPC162742

Ingredient ID: NPC16194

Ingredient ID: NPC161571

Ingredient ID: NPC160125

Ingredient ID: NPC159854

Ingredient ID: NPC159670

Ingredient ID: NPC158565

Ingredient ID: NPC158306

Ingredient ID: NPC156655

Ingredient ID: NPC156654

Ingredient ID: NPC156630

Ingredient ID: NPC15658

Ingredient ID: NPC154932

Ingredient ID: NPC154186

Ingredient ID: NPC15196

Ingredient ID: NPC151500

Ingredient ID: NPC151250

Ingredient ID: NPC150958

Ingredient ID: NPC150950

Ingredient ID: NPC149184

Ingredient ID: NPC148951

Ingredient ID: NPC148174

Ingredient ID: NPC147983

Ingredient ID: NPC146351

Ingredient ID: NPC146197

Ingredient ID: NPC143741

Ingredient ID: NPC143211

Ingredient ID: NPC142989

Ingredient ID: NPC142707

Ingredient ID: NPC142703

Ingredient ID: NPC141645

Ingredient ID: NPC139029

Ingredient ID: NPC137167

Ingredient ID: NPC136571

Ingredient ID: NPC136303

Ingredient ID: NPC135353

Ingredient ID: NPC135088

Ingredient ID: NPC134218

Ingredient ID: NPC132126

Ingredient ID: NPC128075

Ingredient ID: NPC127624

Ingredient ID: NPC126029

Ingredient ID: NPC126004

Ingredient ID: NPC125144

Ingredient ID: NPC125062

Ingredient ID: NPC124318

Ingredient ID: NPC123723

Ingredient ID: NPC122318

Ingredient ID: NPC121744

Ingredient ID: NPC121719

Ingredient ID: NPC119949

Ingredient ID: NPC119271

Ingredient ID: NPC119107

Ingredient ID: NPC118534

Ingredient ID: NPC118452

Ingredient ID: NPC117724

Ingredient ID: NPC116775

Ingredient ID: NPC115723

Ingredient ID: NPC114633

Ingredient ID: NPC110942

Ingredient ID: NPC109298

Ingredient ID: NPC108627

Ingredient ID: NPC108489

Ingredient ID: NPC1075

Ingredient ID: NPC106770

Ingredient ID: NPC106653

Ingredient ID: NPC104788

Ingredient ID: NPC103887

Ingredient ID: NPC103712

Ingredient ID: NPC100773

Ingredient ID: NPC100749

Ingredient ID: NPC100742