• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Achyranthes Bidentata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCTAGCAGAATGACCAGCGAACATGTTTACATATTGCACGGGGAGGGGGTGCTGGCTTGTCCAGTCCCTCCCTAATGTTGGGGAGTTCCCCCTTGATTGGTGGTGCTGCCCAACACAATAACGAACCCCGGCGTGATATGCGCCAAGGAACAAAAATGAGAGTGTGCTTATCCTTACTCGGATATCCGGGTGAGGATGTTGGCACCCAATCTAAGTCATTAAATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAAGCCTTTTGGCCAAGGCACGTCTGCCTGGGCGTCACGCATAGCGTCTCTCCCTACCTCCAAAGTGTGGAGGGGAGAGGAAGATGGTCTCCCATGCCTCACCGGGCGTGGATGGCCTAAATTAGGAAGCCTCGGGATACGAGATGCCGCGGCGATTGGTGGTTGTATACATGGCCTTCCCTCGTGTCGTGCATCACGTAGCCCATGGGGCCTCGTAGGACCCTTAAAAACCT

Click for details-----ITS1

TCGAAACCTGCCTAGCAGAATGACCAGCGAACATGTTTACATATTGCATGGGGAGGGGGTACTGGCTTGTCCAGTCCCTCCCTAATGTTGGGGAGTTCCCCCTTGATTGGTGGTGCTGCCCAACACAATAACGAACCCCGGCGTGATATACGCCAAGGAACAAAAATGAGATTGTGCTTATCCCTACTCGGATTTCCGGGTGAGGATGTTGGCACCCAATCTAAGTCATTAAA

Click for details-----ITS2

ATAGCGTCTCTCCCTACCTCCAAAGTGTGGAGGGGAGAGGAAGATGGTCTCCCATGCCTCACCGGGCGTGGATGGCCTAAATTAGGAAGCCTCGGGATACGAGATGCCGCGGCGATTGGTGGTTGTATACATGGCCTTCCCTCGTGTCGTGCATCACGTAGCCCATGGGGCCTCGTAGGACCCTTAAAAACCT
Taxonomic Information

Plant ID: NPO15077
Plant Latin Name: Achyranthes Bidentata
Taxonomy Genus: Achyranthes
Taxonomy Family: Amaranthaceae

Plant External Links:

NCBI TaxonomyDB: 384659
Plant-of-the-World-Online: 58678-1

Used in Medicines

Country/Region:
Thailand; China; India

Traditional Medicine System:
Indian Folk; TCM; Ayurveda


Medicinal Functions:

Anodyne; Antiasthmatic; Antiinflammatory; Antirheumatic; Bitter; Digestive; Diuretic; Emmenagogue; Odontalgic; Vasodilator

Geographical Distribution

Pakistan; Australia; Angola; Bangladesh; Myanmar; South Africa; Nepal; Philippines; Indonesia; India; Cambodia; United States; Vietnam; China; Laos; Sri Lanka; Japan; Nigeria; Cameroon; Taiwan; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

120 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


51 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

52 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98872

Ingredient ID: NPC97202

Ingredient ID: NPC94101

Ingredient ID: NPC91580

Ingredient ID: NPC84462

Ingredient ID: NPC82835

Ingredient ID: NPC8203

Ingredient ID: NPC81825

Ingredient ID: NPC80854

Ingredient ID: NPC77174

Ingredient ID: NPC76376

Ingredient ID: NPC74901

Ingredient ID: NPC72652

Ingredient ID: NPC6973

Ingredient ID: NPC65077

Ingredient ID: NPC63020

Ingredient ID: NPC58739

Ingredient ID: NPC54558

Ingredient ID: NPC5280

Ingredient ID: NPC50692

Ingredient ID: NPC50114

Ingredient ID: NPC49958

Ingredient ID: NPC479693

Ingredient ID: NPC4778

Ingredient ID: NPC47301

Ingredient ID: NPC41345

Ingredient ID: NPC40775

Ingredient ID: NPC37502

Ingredient ID: NPC36218

Ingredient ID: NPC35501

Ingredient ID: NPC34700

Ingredient ID: NPC329148

Ingredient ID: NPC328572

Ingredient ID: NPC326474

Ingredient ID: NPC322523

Ingredient ID: NPC3224

Ingredient ID: NPC319077

Ingredient ID: NPC318696

Ingredient ID: NPC317622

Ingredient ID: NPC310957

Ingredient ID: NPC307063

Ingredient ID: NPC304423

Ingredient ID: NPC300849

Ingredient ID: NPC298395

Ingredient ID: NPC293714

Ingredient ID: NPC291473

Ingredient ID: NPC290613

Ingredient ID: NPC290598

Ingredient ID: NPC29

Ingredient ID: NPC286347

Ingredient ID: NPC282923

Ingredient ID: NPC279461

Ingredient ID: NPC2789

Ingredient ID: NPC27786

Ingredient ID: NPC273330

Ingredient ID: NPC271027

Ingredient ID: NPC265077

Ingredient ID: NPC260268

Ingredient ID: NPC256321

Ingredient ID: NPC255662

Ingredient ID: NPC251768

Ingredient ID: NPC246654

Ingredient ID: NPC243728

Ingredient ID: NPC242580

Ingredient ID: NPC233970

Ingredient ID: NPC233651

Ingredient ID: NPC233395

Ingredient ID: NPC233122

Ingredient ID: NPC231063

Ingredient ID: NPC230920

Ingredient ID: NPC230301

Ingredient ID: NPC227925

Ingredient ID: NPC227139

Ingredient ID: NPC225118

Ingredient ID: NPC224883

Ingredient ID: NPC22140

Ingredient ID: NPC217415

Ingredient ID: NPC216630

Ingredient ID: NPC214484

Ingredient ID: NPC206879

Ingredient ID: NPC203981

Ingredient ID: NPC202167

Ingredient ID: NPC201437

Ingredient ID: NPC200684

Ingredient ID: NPC192864

Ingredient ID: NPC192791

Ingredient ID: NPC192744

Ingredient ID: NPC192638

Ingredient ID: NPC192040

Ingredient ID: NPC187021

Ingredient ID: NPC180391

Ingredient ID: NPC178383

Ingredient ID: NPC176521

Ingredient ID: NPC176025

Ingredient ID: NPC175972

Ingredient ID: NPC171192

Ingredient ID: NPC167240

Ingredient ID: NPC163866

Ingredient ID: NPC157868

Ingredient ID: NPC153556

Ingredient ID: NPC153344

Ingredient ID: NPC149203

Ingredient ID: NPC142415

Ingredient ID: NPC141953

Ingredient ID: NPC137958

Ingredient ID: NPC135594

Ingredient ID: NPC131709

Ingredient ID: NPC130905

Ingredient ID: NPC130577

Ingredient ID: NPC129165

Ingredient ID: NPC119555

Ingredient ID: NPC114822

Ingredient ID: NPC111710

Ingredient ID: NPC110699

Ingredient ID: NPC108721

Ingredient ID: NPC107482

Ingredient ID: NPC105591

Ingredient ID: NPC102683

Ingredient ID: NPC10251

Ingredient ID: NPC101401