CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Cissus Quinquefolia

Example Image

PLANiTS DNA barcode

Click for details-----ITS

CATTGTCGAACCTCCGAACGACCACCCGCGAACACGTCGTCACGCAACCCCCTCGGGGGGCGAGGGAGCGGGCGCGAGCCCGCCCCCCTCCGCCCCTCGACCGCGCTCGGGGGGCCTCGGGAGCCCCGCCCCCCCTCGCGGGGGGCGCCTCAAGACGGCCCCCTCGAGCGCGAAACGAACCCCGGCGCGGAACGCGCCAAGGAACAACAGAACGAACCAACGCCCTCCCGTCGCCCCGGTCACGGGCGCGTCGGCGAGGCGTCGTCGTTTCAGTCACACAAACGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCACCCGTCGCCCCCCCACCCCCCTTCCCCCTCGGGGAAGAGAGGAGAGGAGGGGGCGGACATTGGCCTCCCGTGGGCGCCCTCGCCCGTGGTTGGCCGAAAATCGGTCCCGCGGCGACGTACGCCACGACGAGCGGTGGATTCGCACGAACCCCCCTCCCTCCCCTCCGCGCGAGAGGGGGGAGAGCAGCTCGGCGTCGCGCGCGTCACGTCGCCCGAGGAGCACCTCCCCCAAGTGAACGGCCCGAGACCCTCGATCGCGACCCCAGGTCAGGCG

Click for details-----ITS1

Click for details-----ITS2

ACTCGTCGCCCCCCCTTCCCCCCTCGAGGCCTCGCGCCCGGGGGGGCGGAGCGGGGGCGGACATTGGCCTCCCGTGGGCTCCCCCGCCCGCGGTTGGCCCAAAATCGGTCCCGCGGCGGCGTACGCCACGACAAGCGGTGGTTTCGTGCATCGGACCCCTCCCCTCCTCCTCCCCGACGGGGGGGAAGAGGCGGAGCAGCTAGTTGTCGCGCGCGGCACGTCGCCTCGACGGCCACCCTTAAAAGGCCCGAGACCCTCGATCGCGACCCCAGGTCAGGCG

Taxonomic Information

Plant ID: NPO1507
Plant Latin Name: Cissus Quinquefolia
Taxonomy Genus: Cissus
Taxonomy Family: Vitaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

76 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

15 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

21 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC98508

Ingredient ID: NPC98204

Ingredient ID: NPC96604

Ingredient ID: NPC92120

Ingredient ID: NPC87558

Ingredient ID: NPC84319

Ingredient ID: NPC71074

Ingredient ID: NPC71056

Ingredient ID: NPC69361

Ingredient ID: NPC61733

Ingredient ID: NPC58190

Ingredient ID: NPC538

Ingredient ID: NPC51700

Ingredient ID: NPC50676

Ingredient ID: NPC48040

Ingredient ID: NPC47521

Ingredient ID: NPC40078

Ingredient ID: NPC39012

Ingredient ID: NPC310014

Ingredient ID: NPC307335

Ingredient ID: NPC30224

Ingredient ID: NPC301989

Ingredient ID: NPC299501

Ingredient ID: NPC298725

Ingredient ID: NPC297205

Ingredient ID: NPC295380

Ingredient ID: NPC290023

Ingredient ID: NPC278956

Ingredient ID: NPC278620

Ingredient ID: NPC271138

Ingredient ID: NPC270768

Ingredient ID: NPC2701

Ingredient ID: NPC266569

Ingredient ID: NPC263935

Ingredient ID: NPC261619

Ingredient ID: NPC259788

Ingredient ID: NPC259733

Ingredient ID: NPC255589

Ingredient ID: NPC25259

Ingredient ID: NPC248331

Ingredient ID: NPC247139

Ingredient ID: NPC243728

Ingredient ID: NPC239947

Ingredient ID: NPC234664

Ingredient ID: NPC228236

Ingredient ID: NPC227918

Ingredient ID: NPC227318

Ingredient ID: NPC225710

Ingredient ID: NPC220134

Ingredient ID: NPC219876

Ingredient ID: NPC218167

Ingredient ID: NPC216888

Ingredient ID: NPC198842

Ingredient ID: NPC193862

Ingredient ID: NPC193505

Ingredient ID: NPC186948

Ingredient ID: NPC179980

Ingredient ID: NPC178134

Ingredient ID: NPC174177

Ingredient ID: NPC173134

Ingredient ID: NPC167303

Ingredient ID: NPC165179

Ingredient ID: NPC158371

Ingredient ID: NPC152743

Ingredient ID: NPC147013

Ingredient ID: NPC146024

Ingredient ID: NPC142415

Ingredient ID: NPC141225

Ingredient ID: NPC140186

Ingredient ID: NPC132088

Ingredient ID: NPC126958

Ingredient ID: NPC122189

Ingredient ID: NPC117118

Ingredient ID: NPC114710

Ingredient ID: NPC113996

Ingredient ID: NPC109878

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	RECQL	ATP-dependent DNA helicase Q1	P46063	CHEMBL1293236
Therapeutic Target	Enzyme	POLB	DNA polymerase beta	P06746	CHEMBL2392
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Enzyme	APEX1	DNA-(apurinic or apyrimidinic site) lyase	P27695	CHEMBL5619
Therapeutic Target	Enzyme	HPGD	15-hydroxyprostaglandin dehydrogenase [NAD+]	P15428	CHEMBL1293255
Therapeutic Target	Lysine demethylase	KDM4E	Lysine-specific demethylase 4D-like	B2RXH2	CHEMBL1293226
Therapeutic Target	Nuclear hormone receptor subfamily 1	NR1H4	Bile acid receptor FXR	Q96RI1	CHEMBL2047
Therapeutic Target	Nuclear hormone receptor subfamily 1	RORC	Nuclear receptor ROR-gamma	P51449	CHEMBL1741186
Therapeutic Target	Other cytosolic protein	HSPA1A	Heat shock 70 kDa protein 1	P0DMV8	CHEMBL5460
Therapeutic Target	Oxidoreductase	AKR1B10	Aldo-keto reductase family 1 member B10	O60218	CHEMBL5983
Therapeutic Target	Oxidoreductase	AKR1B1	Aldose reductase	P15121	CHEMBL1900
Therapeutic Target	Oxidoreductase	HSD11B1	11-beta-hydroxysteroid dehydrogenase 1	P28845	CHEMBL4235
Therapeutic Target	Phosphodiesterase	TDP1	Tyrosyl-DNA phosphodiesterase 1	Q9NUW8	CHEMBL1075138
Therapeutic Target	Protein Kinase	MET	Hepatocyte growth factor receptor	P08581	CHEMBL3717
Therapeutic Target	Protein Kinase	NUAK1	NUAK family SNF1-like kinase 1	O60285	CHEMBL5784
Therapeutic Target	Protein Kinase	SRC	Tyrosine-protein kinase SRC	P12931	CHEMBL267
Therapeutic Target	Protein Kinase	KDR	Vascular endothelial growth factor receptor 2	P35968	CHEMBL279
Therapeutic Target	Protein Kinase	EGFR	Epidermal growth factor receptor erbB1	P00533	CHEMBL203
Therapeutic Target	Protein Kinase	INSR	Insulin receptor	P06213	CHEMBL1981
Therapeutic Target	Protein Kinase	CSNK2A1	Casein kinase II alpha	P68400	CHEMBL3629
Therapeutic Target	Protein Kinase	IGF1R	Insulin-like growth factor I receptor	P08069	CHEMBL1957
Therapeutic Target	Protein Kinase	TEK	Tyrosine-protein kinase TIE-2	Q02763	CHEMBL4128
Therapeutic Target	Protein Phosphatase	CDC25B	Dual specificity phosphatase Cdc25B	P30305	CHEMBL4804
Drug Transporter	SLC superfamily of solute carriers	SLC22A6	Solute carrier family 22 member 6	Q4U2R8	CHEMBL1641347
Drug Transporter	SLC superfamily of solute carriers	SLCO1B3	Solute carrier organic anion transporter family member 1B3	Q9NPD5	CHEMBL1743121
Therapeutic Target	Small molecule receptor (family A GPCR)	GPR35	G-protein coupled receptor 35	Q9HC97	CHEMBL1293267
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Surface antigen	F3	Coagulation factor III	P13726	CHEMBL4081
Therapeutic Target	Transcription factor	SMAD3	Mothers against decapentaplegic homolog 3	P84022	CHEMBL1293258
Therapeutic Target	Transcription factor	RELA	Nuclear factor NF-kappa-B p65 subunit	Q04206	CHEMBL5533
Therapeutic Target	Transferase	FUT7	Alpha-(1,3)-fucosyltransferase 7	Q11130	CHEMBL3596077
Therapeutic Target	Transferase	POLI	DNA polymerase iota	Q9UNA4	CHEMBL5391
Therapeutic Target	Transferase	POLH	DNA polymerase eta	Q9Y253	CHEMBL5542

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	11

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT02660112	(+) Epicatechin to Treat Friedreich's Ataxia	Friedreich ataxia	(+)-Epicatechin (NPC261619)	NP level
NCT04403568	Testing the Synergism of Phytonutrients, Curcumin and Ursolic Acid, to Target Molecular Pathways in the Prostate	prostate cancer	Ursolic Acid (NPC51700)	NP level
NCT02337933	Effect of Ursolic Acid Administration on Insulin Sensitivity and Metabolic Syndrome	metabolic syndrome	Ursolic Acid (NPC51700)	NP level
NCT02656212	Early Phase Pre-Clinical and Initial Clinical Research on Epicatechin (Part 2)	prediabetes syndrome	(+)-Epicatechin (NPC261619)	NP level
NCT02964377	Plus Epicatechin Duchenne Muscular Dystrophy in Non-ambulatory Adolescents	Duchenne muscular dystrophy	(+)-Epicatechin (NPC261619)	NP level
NCT03216876	A Study Of Ursolic Acid For Primary Sclerosing Cholangitis	sclerosing cholangitis	Ursolic Acid (NPC51700)	NP level
NCT01690676	Effect of an Apple Polyphenol Extract on Brachial Artery Flow-mediated Vasodilatory Function	hypertension	(+)-Epicatechin (NPC261619)	NP level
NCT00455416	Dietary Intervention in Follicular Lymphoma	follicular lymphoma	Ellagic Acid (NPC178134)	NP level
NCT04011618	Effect of Ellagic Ácid on the Components of Metabolic Syndrome, Insulin Sensitivity and Insulin Secretion	metabolic syndrome	Ellagic Acid (NPC178134)	NP level
NCT02330276	Early Phase Pre-Clinical and Initial Clinical Research on Epicatechin	prediabetes syndrome	(+)-Epicatechin (NPC261619)	NP level
NCT04386304	Safety and Biomarker Response to (+)-Epicatechin in Becker Muscular Dystrophy	Becker muscular dystrophy	(+)-Epicatechin (NPC261619)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	HPGD,HSD17B10,FUT7,AKR1B10,APEX1,AKR1B1,PTPRC,GALNT2
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	KDR,MET,SRC,TEK,IGF1R,PTPN1,EGFR
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	IGF1R,EGFR,RORC,MET,CDC25B,KDR
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	GPR35,AKR1B10,AKR1B1,SRC,IGF1R,NUAK1
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	SLC22A6,GPR35,AKR1B10,CDC25B,SRC,AKR1B10
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	KDR,LMNA,PTPRC,POLH,AKR1B10,MET
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	INSR,AKR1B1,KDR,PTPN1,HSD11B1
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	IGF1R,KDR,CSNK2A1,MET,EGFR
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	MET,HSPA1A,HSPA1B,KDR,EGFR
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	CDC25B,PTPN1,FUT7,AKR1B10,AKR1B1
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	AKR1B10,MET,FUT7,GPR35,PTPRC
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	SRC,EGFR,IGF1R,F3
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	RORC,INSR SLCO1B3,HSD11B1
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	INSR,HSD11B1,RELA,PTPN1
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	SRC,INSR,KDR,IGF1R
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	PTPN1,HSD11B1 NCT04011618,NCT02337933
Malignant digestive organ neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C11	SRC,HSPA1A,HSPA1B,KDR
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	HSPA1A,PTPRC,HSPA1B,SRC
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	KDR,HSD11B1,INSR,MET
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	MET,IGF1R,EGFR,KDR
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	KDR,MET,SRC,EGFR
Motor neuron disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B60	HSPA1B,IGF1R,SRC,HSPA1A
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	ELAVL3,FUT7,RORC,MET
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	KDM4E,HPGD,ELAVL3,GPR35
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA,EGFR,GPR35,F3
Diabetic foot ulcer Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD54	EGFR,HSPA1A,HSPA1B
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	MET,KDR,EGFR
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	HSPA1B,HSPA1A,AKR1B1
Pleomorphic sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B54	SRC,MET,KDR
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	RELA,RORC,SRC
Retinopathy Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71	TEK,IGF1R,APEX1
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	KDR,SRC,MET
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	AKR1B1,INSR,IGF1R
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	EGFR,MET,KDR
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	SRC,MET,KDR
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	EGFR,KDR,MET
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	RELA,SRC,PTPRC
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	KDR,MET,EGFR
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	MET,CES1,TEK
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	MET,EGFR,KDR
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	RELA,RORC AKR1B10
Herpes simplex infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F00	HSPA1A,SMAD3,HSPA1B
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	AKR1B1,MET,HSD11B1
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	CDC25B,SLCO1B3,MET
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CDC25B,SLCO1B3,MET
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	IGF1R,FUT7,PTPRC
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	SRC,INSR,LMNA
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	CDC25B,SLCO1B3,HSPA1A
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	SLCO1B3,GPR35,AKR1B10
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	GPR35,AKR1B10,SLCO1B3
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	HPGD,POLH,FUT7
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	SMAD3,FUT7,HSD11B1
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	HPGD,FUT7,MET
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	SRC,PTPN1
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	RELA,INSR
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	TEK,SRC
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	EGFR,SRC
Gastrointestinal stromal tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5B	SRC,KDR
Metastatic malignant neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D50-2E09	HSPA1A,HSPA1B
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	AKR1B1,RELA
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	EGFR,PTPRC
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	EGFR,CDC25B
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	SRC,KDR
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	KDR,MET
Unspecific body region injury Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: ND56	EGFR,MET
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	SRC,PTPRC
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	EGFR,KDR
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	HSD11B1,CES1
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	KDR,EGFR
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	HSD11B1,PTPN1
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	HSD11B1,RELA
Ischemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B10-8B11	EGFR,SRC
Intermediate hyperglycaemia, unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A40.Z	NCT02656212,NCT02330276
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	SLCO1B3,HSD11B1
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	AKR1B10,SLCO1B3
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F3,RORC
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	SLCO1B3,AKR1B10
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	SLCO1B3,AKR1B1
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	ELAVL3,FUT7
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	GPR35,MET
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	KDR,HSD17B10,AKR1B1,CSNK2A2,PTPN1,POLH,HSD11B1,RECQL,NUAK1,LMNA,EGFR,APEX1,CSNK2A1,F3,TDP1,SRC,MET,TEK
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CDC25B,KDR,HPGD,PTPRC,LMNA,POLH,RECQL,EGFR,FUT7,AKR1B10,APEX1,TDP1,CSNK2A2,SRC,MET,GALNT2
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	IGF1R,RORC,HSPA1A,CSNK2A1,MET,RELA,POLB,EGFR,KDR,SRC,APEX1,HSPA1B,TEK,F3
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CDC25B,CES1,PTPRC,LMNA,PTPN1,RECQL,FUT7,AKR1B10,POLB,HSD11B1,SLCO1B3,MET,NUAK1,TEK
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	HPGD,PTPRC,TDP1,POLH,ELAVL3,FUT7,AKR1B10,APEX1,CSNK2A1,RORC,SLCO1B3,MET
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CDC25B,KDR,HPGD,SMAD3,PTPRC,SLC22A6,FUT7,AKR1B1,MET,NUAK1,TEK
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	TDP1,HSD17B10,ELAVL3,FUT7,AKR1B10,POLB,AKR1B1,RORC,MET,GALNT2
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	SMAD3,LMNA,ELAVL3,F3,GPR35,CSNK2A1,AKR1B1,SRC,IGF1R,NUAK1
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Extraocular muscle disorder Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C82	IGF1R
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	PTPRC
Intracerebral haemorrhage Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B00	EGFR
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	SRC
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	RELA
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	IGF1R
Spinal cord/cranial nerve neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A02	EGFR
Metastatic biliary tract neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C14-2C17	EGFR
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	IGF1R
Metastatic digestive system neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D8Y	SRC
Ophthalmic devices/implants/grafts injury Disease Category: 23.External causes of morbidity or mortality Disease ICD-11 Code: PK97	PTPN1
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	RELA
Biliary tract cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C17	MET
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	RELA
Autoimmune disease Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40-4A45	RORC
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	RELA
Digestive organ benign neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E92	KDR
Ocular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D00-2D07	APEX1
Acute respiratory distress syndrome Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB00	F3
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	EGFR
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	RELA
Multiple structural anomalies syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2F	IGF1R
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	TEK
Influenza Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E30-1E32	HSD11B1
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	SRC
Malignant mesenchymal neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5D-2B5Y	EGFR
NA Disease Category: NA Disease ICD-11 Code: NA	MET
Cataract Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B10	AKR1B1
Osteosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B51	SRC
Testicular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80	EGFR
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	RELA
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	HSD11B1
Hepatitis virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50-1E51	EGFR
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F3
Thyrotoxicosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A02	IGF1R
Skin postprocedural disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EL8Y	EGFR
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	RELA
Transplanted organ/tissue Disease Category: 24.Factors influencing health status or contact with health services Disease ICD-11 Code: QB63	PTPRC
Cervical cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C77	SRC
Leiomyosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B58	SRC
Synovial sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5A	SRC
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	AKR1B1
Hypopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6D	EGFR
Synthesis disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52-5C59	CES1
Epidermal dysplasias Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK90	SRC
Peroxisomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C57	CES1
Fallopian tube cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C74	SRC
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	KDR
Ischemic heart disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40-BA6Z	MET
Type-1/2 diabete Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A10-5A11	INSR
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	AKR1B1
Skin and skin-structure infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G0Z	RELA
Urethral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C93	EGFR
Lysosomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C56	INSR
Liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB90-DB9Z	MET
Colon cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90	EGFR
Inborn lipid metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52	HSD11B1
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	PTPRC
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	INSR
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	NCT04403568
Follicular lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A80	NCT00455416
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	NCT01690676
Friedreich ataxia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A03.10	NCT02660112
Becker muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70.0	NCT04386304
Duchenne muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70.1	NCT02964377
Primary sclerosing cholangitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB96.2	NCT03216876
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	SMAD3
Idiopathic pulmonary fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03.4	SLCO1B3
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	SLCO1B3
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	HPGD
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	MET
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	SLCO1B3
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	F3
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	MET
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	MET
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	MET
Lyme borreliosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C1G	MET
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	AKR1B10

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Cissus Quinquefolia

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

76 All known Ingredients in Total

15 Ingredients with Acceptable Bioavailablity

21 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Malignant neoplasms of thymus

Breast cancer

Lung cancer

Hepatoblastoma

Hepatocellular carcinoma of liver

Glioblastoma of brain

Acute diabete complication

Liver cancer

Stomach cancer

Leishmaniasis

Other specified malignant neoplasms of kidney, except renal pelvis

Pancreatic cancer

Crohn disease

Type 2 diabetes mellitus

Multiple myeloma

Metabolic disorder

Malignant digestive organ neoplasm

BCR-ABL1-negative chronic myeloid leukaemia

Alzheimer disease

Colorectal cancer

Brain cancer

Motor neuron disease

Pheochromocytoma

Cytomegaloviral disease

Chikungunya virus disease

Diabetic foot ulcer

Head and neck cancer

Neuropathy

Pleomorphic sarcoma

Multiple sclerosis

Retinopathy

Ovarian cancer

Pain, unspecified

Non-small cell lung cancer

Cardiovascular disease

Melanoma

Acute myeloid leukaemia

Renal cell carcinoma

Chronic arterial occlusive disease

Metastatic lymph node neoplasm

Psoriasis

Herpes simplex infection

Glaucoma

Adenocarcinoma of stomach

Other specified malignant neoplasms ofcolon

Melanoma of skin

Superficial ovarian endometriosis

Malignant neoplasms of oesophagus

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Polycystic ovary syndrome

Carpal tunnel syndrome

Malignant neoplasms of adrenal gland

Postoperative inflammation

Diabetes mellitus, type unspecified

Myeloproliferative neoplasm

Mature B-cell leukaemia

Gastrointestinal stromal tumour

Metastatic malignant neoplasm

Rheumatoid arthritis

Mature T-cell lymphoma

Nasopharyngeal cancer

Peritoneal cancer

Thyroid cancer