• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Prunus Persica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCCCTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTAGCAGAACGATCCGAGAACTAGTTTCAAAGCGGGGGGGCGAGGGGCCCTGCGGCTCCTTGTCCCCTTTATCCCGGGGGGGTTGCGCCGCGCTCGCGCGGCCGACCCTTCCGGGCGTACAAACGAACACCGGCGCGAACTGCGCCAAGGAAATTGAACGAGAGAGCGCGTCCCCGTCGCCCCGGAAACGGTGTGCGCGGGCGGCGTCGTCATCTTCAAATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGCCGTTGCCCCCCCCATCTACTCCTTCGGGATTGCGGGGGGGCGGATGATGGCCTCCCGTGCGCCTCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGCACGCCACGACAATCGGTGGTTGCGAAACCTCGGTTGCCCGTCGTGTGCGTTCGTCGCGCATCGAGGGCTCGAAAAAAATGCTCGGCTCCGGCTCGGCTTTCA

Click for details-----ITS1

TCCCTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTAGCAGAACGATCCGAGAACTAGTTTCAAAGCGGGGGGGCGAGGGGCCCTGCGGCTCCTTGTCCCCTTTATCCCGGGGGGGTTGCGCCGCGCTCGCGCGGCCGACCCTTCCGGGCGTACAAACGAACACCGGCGCGAACTGCGCCAAGGAAATTGAACGAGAGAGCGCGTCCCCGTCGCCCCGGAAACGGTGTGCGCGGGCGGCGTCGTCATCTTCAAATATGTCAAAA

Click for details-----ITS2

GCCGTTGCCCCCCCCATCTACTCCTTCGGGATTGGGGGGGGGCGGATGATGGCCTCCCGTGCGCCTTGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGCACGCCACGACAATCGGTGGTTGCGAAACCTCGGTTGCCCGTCGTGTGCGGTCGTCGCGCATCGAGGGCTCGAAAAAAATGCTCGGCTCCGGCTCGGCTTTCAACGCGACCCCAGGTCAGGCGGGGTACCC
Taxonomic Information

Plant ID: NPO14992
Plant Latin Name: Prunus Persica
Taxonomy Genus: Prunus
Taxonomy Family: Rosaceae

Plant External Links:

NCBI TaxonomyDB: 3760
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; China; India

Traditional Medicine System:
Sowa-Rigpa; Unani; Ayurveda; Kampo; TCM; Homeopathy


Medicinal Functions:

Alterative; Anthelmintic; Antiasthmatic; Antihalitosis; Antitussive; Astringent; Demulcent; Diuretic; Emollient; Expectorant; Febrifuge; Haemolytic; Laxative; Sedative

Geographical Distribution

Turkey; India; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

212 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


132 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

114 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9848

Ingredient ID: NPC96123

Ingredient ID: NPC94989

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC93151

Ingredient ID: NPC92659

Ingredient ID: NPC91495

Ingredient ID: NPC90232

Ingredient ID: NPC85985

Ingredient ID: NPC85813

Ingredient ID: NPC83604

Ingredient ID: NPC82360

Ingredient ID: NPC80007

Ingredient ID: NPC79943

Ingredient ID: NPC78540

Ingredient ID: NPC78500

Ingredient ID: NPC72649

Ingredient ID: NPC72024

Ingredient ID: NPC69220

Ingredient ID: NPC67920

Ingredient ID: NPC66624

Ingredient ID: NPC66607

Ingredient ID: NPC62045

Ingredient ID: NPC61504

Ingredient ID: NPC6084

Ingredient ID: NPC60288

Ingredient ID: NPC59650

Ingredient ID: NPC59581

Ingredient ID: NPC58190

Ingredient ID: NPC56161

Ingredient ID: NPC55412

Ingredient ID: NPC51438

Ingredient ID: NPC49151

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490411

Ingredient ID: NPC490383

Ingredient ID: NPC490344

Ingredient ID: NPC490279

Ingredient ID: NPC489907

Ingredient ID: NPC48623

Ingredient ID: NPC42471

Ingredient ID: NPC424

Ingredient ID: NPC39429

Ingredient ID: NPC38779

Ingredient ID: NPC36517

Ingredient ID: NPC35448

Ingredient ID: NPC328447

Ingredient ID: NPC326506

Ingredient ID: NPC326412

Ingredient ID: NPC32603

Ingredient ID: NPC325196

Ingredient ID: NPC320312

Ingredient ID: NPC319713

Ingredient ID: NPC318287

Ingredient ID: NPC317120

Ingredient ID: NPC3165

Ingredient ID: NPC315459

Ingredient ID: NPC314434

Ingredient ID: NPC313179

Ingredient ID: NPC312132

Ingredient ID: NPC311485

Ingredient ID: NPC306607

Ingredient ID: NPC305616

Ingredient ID: NPC301583

Ingredient ID: NPC301242

Ingredient ID: NPC299625

Ingredient ID: NPC299571

Ingredient ID: NPC299480

Ingredient ID: NPC296256

Ingredient ID: NPC295644

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC293183

Ingredient ID: NPC29272

Ingredient ID: NPC291545

Ingredient ID: NPC290144

Ingredient ID: NPC289571

Ingredient ID: NPC287397

Ingredient ID: NPC283274

Ingredient ID: NPC282905

Ingredient ID: NPC281686

Ingredient ID: NPC281335

Ingredient ID: NPC281131

Ingredient ID: NPC280073

Ingredient ID: NPC279894

Ingredient ID: NPC279406

Ingredient ID: NPC278683

Ingredient ID: NPC278112

Ingredient ID: NPC278068

Ingredient ID: NPC277736

Ingredient ID: NPC275462

Ingredient ID: NPC274754

Ingredient ID: NPC272902

Ingredient ID: NPC272614

Ingredient ID: NPC270946

Ingredient ID: NPC270625

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC266389

Ingredient ID: NPC2660

Ingredient ID: NPC264735

Ingredient ID: NPC262505

Ingredient ID: NPC261831

Ingredient ID: NPC260916

Ingredient ID: NPC259873

Ingredient ID: NPC259713

Ingredient ID: NPC259512

Ingredient ID: NPC257124

Ingredient ID: NPC2499

Ingredient ID: NPC246558

Ingredient ID: NPC243728

Ingredient ID: NPC242580

Ingredient ID: NPC241721

Ingredient ID: NPC239406

Ingredient ID: NPC239312

Ingredient ID: NPC238254

Ingredient ID: NPC237812

Ingredient ID: NPC237435

Ingredient ID: NPC236202

Ingredient ID: NPC233533

Ingredient ID: NPC232958

Ingredient ID: NPC230301

Ingredient ID: NPC230221

Ingredient ID: NPC229347

Ingredient ID: NPC227302

Ingredient ID: NPC226453

Ingredient ID: NPC225665

Ingredient ID: NPC224941

Ingredient ID: NPC223695

Ingredient ID: NPC223579

Ingredient ID: NPC222010

Ingredient ID: NPC221992

Ingredient ID: NPC220825

Ingredient ID: NPC219969

Ingredient ID: NPC219876

Ingredient ID: NPC217541

Ingredient ID: NPC216605

Ingredient ID: NPC214776

Ingredient ID: NPC214153

Ingredient ID: NPC21180

Ingredient ID: NPC208936

Ingredient ID: NPC208793

Ingredient ID: NPC208176

Ingredient ID: NPC20791

Ingredient ID: NPC206988

Ingredient ID: NPC204932

Ingredient ID: NPC203468

Ingredient ID: NPC202742

Ingredient ID: NPC199310

Ingredient ID: NPC199072

Ingredient ID: NPC197356

Ingredient ID: NPC196167

Ingredient ID: NPC195265

Ingredient ID: NPC194586

Ingredient ID: NPC193258

Ingredient ID: NPC189436

Ingredient ID: NPC189226

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC184416

Ingredient ID: NPC179694

Ingredient ID: NPC17810

Ingredient ID: NPC177796

Ingredient ID: NPC176740

Ingredient ID: NPC176017

Ingredient ID: NPC174605

Ingredient ID: NPC174246

Ingredient ID: NPC173696

Ingredient ID: NPC169056

Ingredient ID: NPC168579

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC167072

Ingredient ID: NPC166040

Ingredient ID: NPC166018

Ingredient ID: NPC164459

Ingredient ID: NPC163556

Ingredient ID: NPC162806

Ingredient ID: NPC16157

Ingredient ID: NPC160512

Ingredient ID: NPC155185

Ingredient ID: NPC154185

Ingredient ID: NPC153958

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC147983

Ingredient ID: NPC14682

Ingredient ID: NPC146197

Ingredient ID: NPC145045

Ingredient ID: NPC137958

Ingredient ID: NPC136014

Ingredient ID: NPC133358

Ingredient ID: NPC131624

Ingredient ID: NPC130760

Ingredient ID: NPC130683

Ingredient ID: NPC127122

Ingredient ID: NPC126741

Ingredient ID: NPC126681

Ingredient ID: NPC126029

Ingredient ID: NPC122245

Ingredient ID: NPC119508

Ingredient ID: NPC116775

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC111897

Ingredient ID: NPC108811

Ingredient ID: NPC104616

Ingredient ID: NPC103209

Ingredient ID: NPC100665

Ingredient ID: NPC100128