• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Salvia Trijuga


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCGCCCCCTCTCCCCGCGCACAGCGCGGTTTGCAGGGGCGGAAACTGGCCTCCCGTGCGCCCCGGCGTGCGGTTGGCCCAAATGCGATCCCTCGGCGACTCGTATCGCGACAAGTGGTGGTTGAACAACTCACTTTCATGTTGTGCTTCTGCGTCGTTGGTATGGGCATCCGTAAACGACCCAGCGGTGTCGGCGTCGCACGACGCCCCACCTTC
Taxonomic Information

Plant ID: NPO14979
Plant Latin Name: Salvia Trijuga
Taxonomy Genus: Salvia
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 342065
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

29 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


26 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

15 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC988

Ingredient ID: NPC94355

Ingredient ID: NPC93241

Ingredient ID: NPC85771

Ingredient ID: NPC75154

Ingredient ID: NPC71074

Ingredient ID: NPC70741

Ingredient ID: NPC66343

Ingredient ID: NPC485393

Ingredient ID: NPC43655

Ingredient ID: NPC326429

Ingredient ID: NPC323400

Ingredient ID: NPC319674

Ingredient ID: NPC319551

Ingredient ID: NPC316431

Ingredient ID: NPC309036

Ingredient ID: NPC301691

Ingredient ID: NPC290249

Ingredient ID: NPC289432

Ingredient ID: NPC278102

Ingredient ID: NPC265784

Ingredient ID: NPC257948

Ingredient ID: NPC238861

Ingredient ID: NPC235053

Ingredient ID: NPC19102

Ingredient ID: NPC163649

Ingredient ID: NPC158371

Ingredient ID: NPC156654

Ingredient ID: NPC144010