• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Blepharis Sindica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCGCCCCCCCTCCCTCCGGGGCGGGGGGCGGACATTGGCCTCCCGTGCGCTCCCGCGCGCGGCCGGCCCAAATGGGATCCCCCGGCGACGCGCGCCGCGACCAGTGGTGGTTGGTTGAACAGCGCTCAGCTCCCTTGCTGTCCGTCGCGCCCCGCGCCGTCGTCCGGACGGGCATCGCGAACGACCCCGAGCGCGCCCCCCGGGCGCCTCCGACCGCGACCCCAGGTCAGGCGGGATCACCCG
Taxonomic Information

Plant ID: NPO14661
Plant Latin Name: Blepharis Sindica
Taxonomy Genus: Blepharis
Taxonomy Family: Acanthaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

63 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


47 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

18 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97001

Ingredient ID: NPC96257

Ingredient ID: NPC96068

Ingredient ID: NPC95704

Ingredient ID: NPC95162

Ingredient ID: NPC90803

Ingredient ID: NPC88566

Ingredient ID: NPC88359

Ingredient ID: NPC82159

Ingredient ID: NPC79409

Ingredient ID: NPC78326

Ingredient ID: NPC66577

Ingredient ID: NPC58779

Ingredient ID: NPC58518

Ingredient ID: NPC57107

Ingredient ID: NPC4942

Ingredient ID: NPC47946

Ingredient ID: NPC44923

Ingredient ID: NPC43643

Ingredient ID: NPC4030

Ingredient ID: NPC3155

Ingredient ID: NPC310852

Ingredient ID: NPC310348

Ingredient ID: NPC295318

Ingredient ID: NPC293378

Ingredient ID: NPC288932

Ingredient ID: NPC283746

Ingredient ID: NPC281131

Ingredient ID: NPC279969

Ingredient ID: NPC275670

Ingredient ID: NPC269030

Ingredient ID: NPC255042

Ingredient ID: NPC251666

Ingredient ID: NPC249736

Ingredient ID: NPC246207

Ingredient ID: NPC241180

Ingredient ID: NPC237499

Ingredient ID: NPC237280

Ingredient ID: NPC236896

Ingredient ID: NPC22725

Ingredient ID: NPC212950

Ingredient ID: NPC20791

Ingredient ID: NPC206264

Ingredient ID: NPC202189

Ingredient ID: NPC201704

Ingredient ID: NPC189214

Ingredient ID: NPC179574

Ingredient ID: NPC178620

Ingredient ID: NPC176965

Ingredient ID: NPC176819

Ingredient ID: NPC170735

Ingredient ID: NPC168057

Ingredient ID: NPC162760

Ingredient ID: NPC144849

Ingredient ID: NPC144590

Ingredient ID: NPC140438

Ingredient ID: NPC140249

Ingredient ID: NPC128048

Ingredient ID: NPC126803

Ingredient ID: NPC121012

Ingredient ID: NPC116864

Ingredient ID: NPC111451

Ingredient ID: NPC105689