• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Lobelia Chinensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCCGCAAAGCAGAACGACCCGCGAACGAGTTAAAAAACATTCTTTAAGTCCGTCGTGCGGGGGCGACCCCCGTTCGGCGGCGCCTAACGAACCCCGGCGCGATCCGCGCCAAGGAATACTCATGAAACTCGAGGTCGCTCCGGCCCGGCGCAGCCCCGTTCGCGGGCGCGCGCGCCGGTCCCGGTGTCGCCGCGAAAGATAACACAAAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCTAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCTCCCCCCGAGCATACATATATATATATGTGCACGGGGGAAGCGGATACTGGCCTCCCGTGCCCCTCGCGGACGCGGCTGGCTCAAAACGGAGTCCCCGACGGAGGACGCACGACAAGTGGTGGTGGTTTTACAAAAGCACTCGCGTCGTGTCGTGCGCGCGTCCTGCGCCGGTGCCGGCTCGCGTGACCCTCTTGCGCCTCCCTCGCTCCCGCGACGGACGGTGCTCGACCGCGACCTATAGTTAGGACGAGGTCCAA

Click for details-----ITS1

TCGAAACCTGCCCGCAAAGCAGAACGACCCGCGAACGAGTTAAAAAACATTCTTTAAGTCCGTCGTGCGGGGGCGACCCCCGTTCGGCGGCGCCTAACGAACCCCGGCGCGATCCGCGCCAAGGAATACTCATGAAACTCGAGGTCGCTCCGGCCCGGCGCAGCCCCGTTCGCGGGCGCGCGCGCCGGTCCCGGTGTCGCCGCGAAAGATAACACAAAA

Click for details-----ITS2

ATCGCGTCGCTCCCCCCGAGCATACATATATATATATGTGCACGGGGGAAGCGGATACTGGCCTCCCGTGCCCCTCGCGGACGCGGCTGGCTCAAAACGGAGTCCCCGACGGAGGACGCACGACAAGTGGTGGTGGTTTTACAAAAGCACTCGCGTCGTGTCGTGCGCGCGTCCTGCGCCGGTGCCGGCTCGCGTGACCCTCTTGCGCCTCCCTCGCTCCCGCGACGGACGGTGCTCGACCGCGACCTATAGTTAGGACGAGGTCCAA
Taxonomic Information

Plant ID: NPO14650
Plant Latin Name: Lobelia Chinensis
Taxonomy Genus: Lobelia
Taxonomy Family: Campanulaceae

Plant External Links:

NCBI TaxonomyDB: 368926
Plant-of-the-World-Online: 143086-1

Used in Medicines

Country/Region:
Thailand; China; India

Traditional Medicine System:
Indian Folk; TCM

Geographical Distribution

Bangladesh; South Africa; Nepal; India; Cambodia; Vietnam; China; Laos; Sri Lanka; Japan; Taiwan; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

123 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


91 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

69 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95675

Ingredient ID: NPC85473

Ingredient ID: NPC82271

Ingredient ID: NPC79056

Ingredient ID: NPC75709

Ingredient ID: NPC75204

Ingredient ID: NPC7491

Ingredient ID: NPC67761

Ingredient ID: NPC67462

Ingredient ID: NPC66681

Ingredient ID: NPC65855

Ingredient ID: NPC62727

Ingredient ID: NPC59581

Ingredient ID: NPC52005

Ingredient ID: NPC51758

Ingredient ID: NPC50898

Ingredient ID: NPC49168

Ingredient ID: NPC49151

Ingredient ID: NPC46248

Ingredient ID: NPC44931

Ingredient ID: NPC44328

Ingredient ID: NPC43728

Ingredient ID: NPC42471

Ingredient ID: NPC41538

Ingredient ID: NPC39360

Ingredient ID: NPC37205

Ingredient ID: NPC3665

Ingredient ID: NPC33489

Ingredient ID: NPC329148

Ingredient ID: NPC325762

Ingredient ID: NPC323515

Ingredient ID: NPC32279

Ingredient ID: NPC32222

Ingredient ID: NPC321150

Ingredient ID: NPC312132

Ingredient ID: NPC310820

Ingredient ID: NPC307011

Ingredient ID: NPC305663

Ingredient ID: NPC30315

Ingredient ID: NPC301585

Ingredient ID: NPC29883

Ingredient ID: NPC298796

Ingredient ID: NPC297844

Ingredient ID: NPC297527

Ingredient ID: NPC294136

Ingredient ID: NPC293353

Ingredient ID: NPC292758

Ingredient ID: NPC290613

Ingredient ID: NPC290598

Ingredient ID: NPC29

Ingredient ID: NPC288932

Ingredient ID: NPC286774

Ingredient ID: NPC285394

Ingredient ID: NPC279121

Ingredient ID: NPC277907

Ingredient ID: NPC277439

Ingredient ID: NPC26906

Ingredient ID: NPC265498

Ingredient ID: NPC257885

Ingredient ID: NPC252230

Ingredient ID: NPC249801

Ingredient ID: NPC248726

Ingredient ID: NPC246358

Ingredient ID: NPC243728

Ingredient ID: NPC241721

Ingredient ID: NPC240722

Ingredient ID: NPC236709

Ingredient ID: NPC233533

Ingredient ID: NPC232132

Ingredient ID: NPC231738

Ingredient ID: NPC230301

Ingredient ID: NPC226944

Ingredient ID: NPC22140

Ingredient ID: NPC220239

Ingredient ID: NPC217226

Ingredient ID: NPC216630

Ingredient ID: NPC214584

Ingredient ID: NPC210831

Ingredient ID: NPC210003

Ingredient ID: NPC209970

Ingredient ID: NPC209296

Ingredient ID: NPC209279

Ingredient ID: NPC209275

Ingredient ID: NPC208757

Ingredient ID: NPC208075

Ingredient ID: NPC20791

Ingredient ID: NPC205999

Ingredient ID: NPC202956

Ingredient ID: NPC200837

Ingredient ID: NPC197811

Ingredient ID: NPC197783

Ingredient ID: NPC194586

Ingredient ID: NPC193335

Ingredient ID: NPC192872

Ingredient ID: NPC183950

Ingredient ID: NPC181939

Ingredient ID: NPC177874

Ingredient ID: NPC176521

Ingredient ID: NPC167336

Ingredient ID: NPC166692

Ingredient ID: NPC164706

Ingredient ID: NPC16157

Ingredient ID: NPC161555

Ingredient ID: NPC160931

Ingredient ID: NPC159963

Ingredient ID: NPC155209

Ingredient ID: NPC155182

Ingredient ID: NPC148039

Ingredient ID: NPC139548

Ingredient ID: NPC139416

Ingredient ID: NPC138811

Ingredient ID: NPC13789

Ingredient ID: NPC134732

Ingredient ID: NPC126682

Ingredient ID: NPC120253

Ingredient ID: NPC117355

Ingredient ID: NPC109813

Ingredient ID: NPC108494

Ingredient ID: NPC107482

Ingredient ID: NPC106250

Ingredient ID: NPC102091

Ingredient ID: NPC101285

Ingredient ID: NPC100039