• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Santolina Rosmarinifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCGCCCCCCGCAAATCTATGTCGGGGGGCGGATATTGGTCTCCCGTGCTCACGGCGTGGTTGGCCAAAATAGGAGTCCCTTCGATGGACGCACAAACTAGTGGTGGTCGTAAAAACCCTCGTTCTTTGTTTTGTGTCGTACGTCGCTAGGAAACACTCTCTAAATACCCCAACGTGTTGTCTTAGGATGACGCTTCGACCGCGACCCCAGGTCAGG
Taxonomic Information

Plant ID: NPO14625
Plant Latin Name: Santolina Rosmarinifolia
Taxonomy Genus: Santolina
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 99098
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Portugal

Traditional Medicine System:

Geographical Distribution

Portugal

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

58 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


57 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

17 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9611

Ingredient ID: NPC94399

Ingredient ID: NPC93500

Ingredient ID: NPC87397

Ingredient ID: NPC86054

Ingredient ID: NPC85346

Ingredient ID: NPC75425

Ingredient ID: NPC74304

Ingredient ID: NPC7365

Ingredient ID: NPC71786

Ingredient ID: NPC71536

Ingredient ID: NPC71347

Ingredient ID: NPC67308

Ingredient ID: NPC65786

Ingredient ID: NPC47724

Ingredient ID: NPC3936

Ingredient ID: NPC31428

Ingredient ID: NPC308718

Ingredient ID: NPC302293

Ingredient ID: NPC299804

Ingredient ID: NPC298049

Ingredient ID: NPC29183

Ingredient ID: NPC291704

Ingredient ID: NPC288298

Ingredient ID: NPC282086

Ingredient ID: NPC279980

Ingredient ID: NPC279696

Ingredient ID: NPC273699

Ingredient ID: NPC269171

Ingredient ID: NPC264779

Ingredient ID: NPC26417

Ingredient ID: NPC253729

Ingredient ID: NPC250543

Ingredient ID: NPC249714

Ingredient ID: NPC238010

Ingredient ID: NPC237460

Ingredient ID: NPC230301

Ingredient ID: NPC224731

Ingredient ID: NPC216489

Ingredient ID: NPC212625

Ingredient ID: NPC200528

Ingredient ID: NPC198251

Ingredient ID: NPC197606

Ingredient ID: NPC184049

Ingredient ID: NPC180968

Ingredient ID: NPC179169

Ingredient ID: NPC173265

Ingredient ID: NPC172653

Ingredient ID: NPC163294

Ingredient ID: NPC155025

Ingredient ID: NPC151923

Ingredient ID: NPC139548

Ingredient ID: NPC129841

Ingredient ID: NPC120926

Ingredient ID: NPC114979

Ingredient ID: NPC109813

Ingredient ID: NPC108960

Ingredient ID: NPC104387