• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Heliotropium Indicum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGGTCGAATCCTGCAAGCAGAACAACCCGCGAACACGATTTCTATCTCTAGGGCCTCGAAGGGCAACCTTCGTGGCCCAAGGTTGGGGCCTAGCCCCACCAAAACTAACCCCGGCGCGGAATGCGCCAAGGAAAACTAAAACGAAGGCCTTCCTCATACCGTCCCGTTCGCGGAGCGCGGGTTGAGGGTACGGCTTATTTCGAAACAAAAACAACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCAAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCAACCAATCTTGTTGGGGGCGGAATTTGGTCTCCCGTGCCTAAGGCGTGGTTGGCCAAAATGTGAGTCCGGCACGACGGACGTCACGACAAGTGGTGGTTGGATATTTCAACTCGCGTGTTGTCGTGGTGTTTACCGTCGTGTCCCGGAGACTGACGAGACCCTCATGCGCTTGCCTCCCAAGAGGAGCCTTGCGCTACGACCGCGACCCCAGGTCAGGC

Click for details-----ITS1

TGGTCGAATCCTGCAAGCAGAACAACCCGCGAACACGATTTCTATCTCTAGGGCCTCGAAGGGCAACCTTCGTGGCCCAAGGTTGGGGCCTAGCCCCACCAAAACTAACCCCGGCGCGGAATGCGCCAAGGAAAACTAAAACGAAGGCCTTCCTCATACCGTCCCGTTCGCGGAGCGCGGGTTGAGGGTACGGCTTATTTCGAAACAAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCAACCAATCTTGTTGGGGGCGGAATTTGGTCTCCCGTGCCTAAGGCGTGGTTGGCCAAAATGTGAGTCCGGCACGACGGACGTCACGACAAGTGGTGGTTGGATATTTCAACTCGCGTGTTGTCGTGGTGTTTACCGTCGTGTCCCGGAGACTGACGAGACCCTCATGCGCTTGCCTCCCAAGAGGAGCCTTGCGCTACGACCGCGACCCCAGGTCAGGC
Taxonomic Information

Plant ID: NPO146
Plant Latin Name: Heliotropium Indicum
Taxonomy Genus: Heliotropium
Taxonomy Family: Heliotropiaceae

Plant External Links:

NCBI TaxonomyDB: 248297
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Ghana; Guinea; Tanzania; Indonesia; India; Laos; Malaysia; Rwanda; Vietnam; Thailand; Kenya; Nigeria; Philippines

Traditional Medicine System:

Geographical Distribution

Ghana; Guinea; Philippines; Indonesia; India; Malaysia; Rwanda; Vietnam; Laos; Kenya; Nigeria; Tanzania; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

18 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


13 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

9 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96192

Ingredient ID: NPC93177

Ingredient ID: NPC85689

Ingredient ID: NPC84379

Ingredient ID: NPC81854

Ingredient ID: NPC64168

Ingredient ID: NPC6166

Ingredient ID: NPC54179

Ingredient ID: NPC53109

Ingredient ID: NPC322627

Ingredient ID: NPC284644

Ingredient ID: NPC280946

Ingredient ID: NPC191407

Ingredient ID: NPC173690

Ingredient ID: NPC165967

Ingredient ID: NPC160359

Ingredient ID: NPC139004

Ingredient ID: NPC137396