• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Elsholtzia Stauntonii


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCAAAGCAGACCGCGAACACGTGTTTAACATCATCGGGCGCGGCGTGGGGGCAACTCCCGCTGTGTCCCGCCCCCGCCGGTGCTCGCTCTTGAGTGATGCATCGTGCGGGCTAACGAACCCCGGCGCGGCAAGCGCCAAGGAAAACTGAATTTAGCGTCTCCCTCCGCATCCCGTTCGCGGGGCGTGCGGGGGTGTTGACGTCTAACGAATGTCATAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCTCCCCGCGCTATGCGCTTGCGAGTGGGGCGGATATTGGCCTCCCGTTCGCCTCGGCGTGCGGCTGGCCCAAATGCGATCCCTCGGCGACTCGCGTCGCGACAAGTGGTGGTTGATAGCTCAATCTCGCGTCTCGTCGCGTGCCGCGTCGTCGTCCGTATGGGCATCGGATAAAGACCCAGCGGTTTCGGTGCGTCATCGCACCGTGCCTACGA

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO14583
Plant Latin Name: Elsholtzia Stauntonii
Taxonomy Genus: Elsholtzia
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 41226
Plant-of-the-World-Online: 446697-1

Used in Medicines

Unknown.

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

105 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


66 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

11 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC91411

Ingredient ID: NPC87590

Ingredient ID: NPC86906

Ingredient ID: NPC82989

Ingredient ID: NPC82329

Ingredient ID: NPC80436

Ingredient ID: NPC74856

Ingredient ID: NPC7214

Ingredient ID: NPC71691

Ingredient ID: NPC69144

Ingredient ID: NPC67816

Ingredient ID: NPC64246

Ingredient ID: NPC60657

Ingredient ID: NPC60372

Ingredient ID: NPC58208

Ingredient ID: NPC49653

Ingredient ID: NPC49070

Ingredient ID: NPC48660

Ingredient ID: NPC46915

Ingredient ID: NPC45267

Ingredient ID: NPC4230

Ingredient ID: NPC40174

Ingredient ID: NPC36266

Ingredient ID: NPC354

Ingredient ID: NPC34884

Ingredient ID: NPC32905

Ingredient ID: NPC31485

Ingredient ID: NPC310432

Ingredient ID: NPC306581

Ingredient ID: NPC306286

Ingredient ID: NPC305201

Ingredient ID: NPC300241

Ingredient ID: NPC29852

Ingredient ID: NPC293776

Ingredient ID: NPC284838

Ingredient ID: NPC283277

Ingredient ID: NPC280090

Ingredient ID: NPC279514

Ingredient ID: NPC271648

Ingredient ID: NPC271343

Ingredient ID: NPC262372

Ingredient ID: NPC26176

Ingredient ID: NPC258693

Ingredient ID: NPC248058

Ingredient ID: NPC24733

Ingredient ID: NPC244582

Ingredient ID: NPC243935

Ingredient ID: NPC239126

Ingredient ID: NPC233256

Ingredient ID: NPC229215

Ingredient ID: NPC22771

Ingredient ID: NPC226850

Ingredient ID: NPC220949

Ingredient ID: NPC219768

Ingredient ID: NPC217788

Ingredient ID: NPC21773

Ingredient ID: NPC217129

Ingredient ID: NPC216693

Ingredient ID: NPC213631

Ingredient ID: NPC208580

Ingredient ID: NPC208010

Ingredient ID: NPC206632

Ingredient ID: NPC205595

Ingredient ID: NPC200794

Ingredient ID: NPC198694

Ingredient ID: NPC197292

Ingredient ID: NPC196134

Ingredient ID: NPC195456

Ingredient ID: NPC18509

Ingredient ID: NPC182962

Ingredient ID: NPC181165

Ingredient ID: NPC178831

Ingredient ID: NPC173565

Ingredient ID: NPC169375

Ingredient ID: NPC168551

Ingredient ID: NPC164973

Ingredient ID: NPC163329

Ingredient ID: NPC158755

Ingredient ID: NPC158162

Ingredient ID: NPC158032

Ingredient ID: NPC154397

Ingredient ID: NPC152829

Ingredient ID: NPC152039

Ingredient ID: NPC149281

Ingredient ID: NPC148164

Ingredient ID: NPC145773

Ingredient ID: NPC14522

Ingredient ID: NPC140419

Ingredient ID: NPC134847

Ingredient ID: NPC129988

Ingredient ID: NPC127780

Ingredient ID: NPC12578

Ingredient ID: NPC121855

Ingredient ID: NPC120458

Ingredient ID: NPC118329

Ingredient ID: NPC116350

Ingredient ID: NPC116123

Ingredient ID: NPC115311

Ingredient ID: NPC113405

Ingredient ID: NPC109268

Ingredient ID: NPC105504

Ingredient ID: NPC1041

Ingredient ID: NPC103593

Ingredient ID: NPC102622

Ingredient ID: NPC101042