• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Spinacia Oleracea


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCCAGCAGAGCGACTAGTAACGTGTTTATCATACGCGGGGGAGGGGGCGCTCCGGCGCCCGCGAGCCCACGCAGGGGGGTGCGAGCCTTCCCGCCTCTATGGGACGGGGAGCCCTTCCGGCAAAACAACGAACCCCGGCGCGGTCTGCACCAAGGAACATGAATACAAGCGTGCCCGCCCCTCACCGGTTCGCCGGGTCGGGGCGCGGCACCAAGTCGTATAAAACATTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAAAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCACCCGAAGCCTTCTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCTCCCCCAACCCGCGCACAGCGGGGCGGAGGAGGAGGATGGCCTCCCACGCCTCACCGGGCGTGGATGGCCTAAATAAGGAGCCCCCGGATACGAACTGCCGCGGCGATAGGTGGTAGACAGGGCCTTAAAAATCCCAGGATGCATCGCGTCGCGCAGCACGTAGCTCCCGAGGCCTCGAAGGACCCCAATGTTGTCTCCCTTAACCGGGACGGCAAAACCG

Click for details-----ITS1

TCGAAACCTGCCCAGCAGAGCGACCAGCGAACGTGTTTATCATAWGCGGGGGAGGGGGCGCTCCGGCGCCCGCGAGCCCGCGCCGGGGGGTGCAAGCCTTCTCGCCTCGGCGGGACGGGGAGCCCCTCCGGCACAACAACGAACCCCGGCGCGGTCTGCGCCAAGGAACATGAATACAAGCGTGCCCGYYCCTTCCCGGTTCGCCGGGTCGGGGCGTGGCACCAAGTCGTATAAAACATTAAA

Click for details-----ITS2

ATCGCGTCTCCCCCAACCCGCGCACAGCGGGGCGGAGGAGGAGGATGGCCTCCCACGCCTCACCGGGCGTGGATGGCCTAAATAAGGAGCCCCCGGATACGAACTGCCGCGGCGATAGGTGGTAGACAGGGCCTTAAAAATCCCAGGATGCATCGCGTCGCGCAGCACGTAGCTCCCGAGGCCTCGAAGGACCCCAATGTTGTCTCCCTTAACCGGGACGGCAAAACCG
Taxonomic Information

Plant ID: NPO14582
Plant Latin Name: Spinacia Oleracea
Taxonomy Genus: Spinacia
Taxonomy Family: Chenopodiaceae

Plant External Links:

NCBI TaxonomyDB: 3562
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Jordan; China; India

Traditional Medicine System:
Indian Folk; TCM; Unani; Ayurveda; Siddha


Medicinal Functions:

Appetizer; Carminative; Febrifuge; Hypoglycaemic; Laxative

Geographical Distribution

Turkey; India; Jordan; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

194 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


119 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

101 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95920

Ingredient ID: NPC95381

Ingredient ID: NPC94930

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC91604

Ingredient ID: NPC88186

Ingredient ID: NPC85813

Ingredient ID: NPC85488

Ingredient ID: NPC83733

Ingredient ID: NPC81010

Ingredient ID: NPC80427

Ingredient ID: NPC79835

Ingredient ID: NPC78312

Ingredient ID: NPC77225

Ingredient ID: NPC77184

Ingredient ID: NPC76902

Ingredient ID: NPC75742

Ingredient ID: NPC7479

Ingredient ID: NPC692

Ingredient ID: NPC68779

Ingredient ID: NPC65089

Ingredient ID: NPC64381

Ingredient ID: NPC64124

Ingredient ID: NPC63842

Ingredient ID: NPC62045

Ingredient ID: NPC60151

Ingredient ID: NPC59650

Ingredient ID: NPC58827

Ingredient ID: NPC56223

Ingredient ID: NPC55412

Ingredient ID: NPC491288

Ingredient ID: NPC491218

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490332

Ingredient ID: NPC490284

Ingredient ID: NPC490282

Ingredient ID: NPC490281

Ingredient ID: NPC490249

Ingredient ID: NPC489907

Ingredient ID: NPC48623

Ingredient ID: NPC47198

Ingredient ID: NPC45782

Ingredient ID: NPC4309

Ingredient ID: NPC424

Ingredient ID: NPC41326

Ingredient ID: NPC37250

Ingredient ID: NPC33378

Ingredient ID: NPC328447

Ingredient ID: NPC32833

Ingredient ID: NPC327524

Ingredient ID: NPC327445

Ingredient ID: NPC326391

Ingredient ID: NPC322254

Ingredient ID: NPC321251

Ingredient ID: NPC318696

Ingredient ID: NPC317120

Ingredient ID: NPC313955

Ingredient ID: NPC309330

Ingredient ID: NPC30856

Ingredient ID: NPC307270

Ingredient ID: NPC307113

Ingredient ID: NPC305944

Ingredient ID: NPC304552

Ingredient ID: NPC301950

Ingredient ID: NPC300059

Ingredient ID: NPC295644

Ingredient ID: NPC294548

Ingredient ID: NPC293714

Ingredient ID: NPC293628

Ingredient ID: NPC291473

Ingredient ID: NPC290319

Ingredient ID: NPC284104

Ingredient ID: NPC281686

Ingredient ID: NPC279661

Ingredient ID: NPC279121

Ingredient ID: NPC27836

Ingredient ID: NPC274516

Ingredient ID: NPC273965

Ingredient ID: NPC272614

Ingredient ID: NPC270674

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC268755

Ingredient ID: NPC267179

Ingredient ID: NPC265305

Ingredient ID: NPC26306

Ingredient ID: NPC262922

Ingredient ID: NPC261831

Ingredient ID: NPC257582

Ingredient ID: NPC25455

Ingredient ID: NPC251162

Ingredient ID: NPC250781

Ingredient ID: NPC245346

Ingredient ID: NPC245027

Ingredient ID: NPC243014

Ingredient ID: NPC242580

Ingredient ID: NPC242419

Ingredient ID: NPC237812

Ingredient ID: NPC236965

Ingredient ID: NPC236340

Ingredient ID: NPC232572

Ingredient ID: NPC232440

Ingredient ID: NPC232176

Ingredient ID: NPC230301

Ingredient ID: NPC229235

Ingredient ID: NPC228839

Ingredient ID: NPC22861

Ingredient ID: NPC228346

Ingredient ID: NPC227952

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC225752

Ingredient ID: NPC2232

Ingredient ID: NPC222696

Ingredient ID: NPC220765

Ingredient ID: NPC219143

Ingredient ID: NPC217245

Ingredient ID: NPC216515

Ingredient ID: NPC214869

Ingredient ID: NPC213876

Ingredient ID: NPC212874

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC205152

Ingredient ID: NPC204025

Ingredient ID: NPC203468

Ingredient ID: NPC202244

Ingredient ID: NPC199072

Ingredient ID: NPC197087

Ingredient ID: NPC195749

Ingredient ID: NPC193989

Ingredient ID: NPC192942

Ingredient ID: NPC192040

Ingredient ID: NPC189436

Ingredient ID: NPC187770

Ingredient ID: NPC187058

Ingredient ID: NPC185755

Ingredient ID: NPC184608

Ingredient ID: NPC180256

Ingredient ID: NPC1786

Ingredient ID: NPC17810

Ingredient ID: NPC177996

Ingredient ID: NPC176740

Ingredient ID: NPC176017

Ingredient ID: NPC175795

Ingredient ID: NPC174304

Ingredient ID: NPC174246

Ingredient ID: NPC16983

Ingredient ID: NPC169749

Ingredient ID: NPC169493

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC161593

Ingredient ID: NPC161543

Ingredient ID: NPC160633

Ingredient ID: NPC157215

Ingredient ID: NPC154710

Ingredient ID: NPC153375

Ingredient ID: NPC152451

Ingredient ID: NPC151448

Ingredient ID: NPC150950

Ingredient ID: NPC147983

Ingredient ID: NPC147753

Ingredient ID: NPC146422

Ingredient ID: NPC145901

Ingredient ID: NPC142989

Ingredient ID: NPC139665

Ingredient ID: NPC137958

Ingredient ID: NPC136633

Ingredient ID: NPC136476

Ingredient ID: NPC136014

Ingredient ID: NPC135539

Ingredient ID: NPC133183

Ingredient ID: NPC130683

Ingredient ID: NPC129683

Ingredient ID: NPC129253

Ingredient ID: NPC129165

Ingredient ID: NPC126925

Ingredient ID: NPC126681

Ingredient ID: NPC125736

Ingredient ID: NPC123677

Ingredient ID: NPC122819

Ingredient ID: NPC119405

Ingredient ID: NPC119343

Ingredient ID: NPC118429

Ingredient ID: NPC116775

Ingredient ID: NPC115723

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC111132

Ingredient ID: NPC111131

Ingredient ID: NPC110297