• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Mentha Spicata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGTGTCGTCCCCCACCCCCGCGCGCATCGCCGGGTGGTTGGGGGCGGACACTAGCCTTCCATGCACCTCGGCGTGTGGCCGGCCCAAATGAGATCCCCGGGCGACTGGCGTCGCGACAAGTGGTGGTTGAACATCTCAATCTCTATCATGGTCGTGCTACCGTCTCGTCCCGTACAGGAATCGAAAATGACCCAACAGTGCTCGGCGTGAATAGCATCTCACCTTCAA
Taxonomic Information

Plant ID: NPO14579
Plant Latin Name: Mentha Spicata
Taxonomy Genus: Mentha
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 29719
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

126 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


111 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

78 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC88566

Ingredient ID: NPC87828

Ingredient ID: NPC84599

Ingredient ID: NPC78551

Ingredient ID: NPC76817

Ingredient ID: NPC7314

Ingredient ID: NPC72285

Ingredient ID: NPC71092

Ingredient ID: NPC70744

Ingredient ID: NPC64176

Ingredient ID: NPC62731

Ingredient ID: NPC62045

Ingredient ID: NPC61

Ingredient ID: NPC60151

Ingredient ID: NPC59035

Ingredient ID: NPC58970

Ingredient ID: NPC55412

Ingredient ID: NPC50898

Ingredient ID: NPC50403

Ingredient ID: NPC49151

Ingredient ID: NPC490083

Ingredient ID: NPC490044

Ingredient ID: NPC489913

Ingredient ID: NPC489912

Ingredient ID: NPC489907

Ingredient ID: NPC489890

Ingredient ID: NPC45270

Ingredient ID: NPC41865

Ingredient ID: NPC3649

Ingredient ID: NPC34764

Ingredient ID: NPC328447

Ingredient ID: NPC317120

Ingredient ID: NPC313955

Ingredient ID: NPC309472

Ingredient ID: NPC307151

Ingredient ID: NPC301195

Ingredient ID: NPC296337

Ingredient ID: NPC294902

Ingredient ID: NPC290843

Ingredient ID: NPC289366

Ingredient ID: NPC287550

Ingredient ID: NPC287331

Ingredient ID: NPC281686

Ingredient ID: NPC278068

Ingredient ID: NPC272614

Ingredient ID: NPC269919

Ingredient ID: NPC26906

Ingredient ID: NPC268564

Ingredient ID: NPC26600

Ingredient ID: NPC265305

Ingredient ID: NPC259512

Ingredient ID: NPC259105

Ingredient ID: NPC25771

Ingredient ID: NPC255042

Ingredient ID: NPC249815

Ingredient ID: NPC246443

Ingredient ID: NPC246165

Ingredient ID: NPC246026

Ingredient ID: NPC240206

Ingredient ID: NPC239037

Ingredient ID: NPC237812

Ingredient ID: NPC232247

Ingredient ID: NPC231738

Ingredient ID: NPC23085

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC225710

Ingredient ID: NPC219143

Ingredient ID: NPC213876

Ingredient ID: NPC213749

Ingredient ID: NPC21038

Ingredient ID: NPC208793

Ingredient ID: NPC203468

Ingredient ID: NPC202189

Ingredient ID: NPC200210

Ingredient ID: NPC198658

Ingredient ID: NPC19319

Ingredient ID: NPC19003

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC184626

Ingredient ID: NPC180871

Ingredient ID: NPC17810

Ingredient ID: NPC177112

Ingredient ID: NPC176309

Ingredient ID: NPC175987

Ingredient ID: NPC174246

Ingredient ID: NPC174065

Ingredient ID: NPC167400

Ingredient ID: NPC166894

Ingredient ID: NPC166362

Ingredient ID: NPC165929

Ingredient ID: NPC163984

Ingredient ID: NPC163556

Ingredient ID: NPC161316

Ingredient ID: NPC16070

Ingredient ID: NPC154685

Ingredient ID: NPC154493

Ingredient ID: NPC154480

Ingredient ID: NPC152451

Ingredient ID: NPC151620

Ingredient ID: NPC150950

Ingredient ID: NPC14917

Ingredient ID: NPC148216

Ingredient ID: NPC147983

Ingredient ID: NPC145590

Ingredient ID: NPC145157

Ingredient ID: NPC138347

Ingredient ID: NPC138113

Ingredient ID: NPC137958

Ingredient ID: NPC13402

Ingredient ID: NPC128863

Ingredient ID: NPC126681

Ingredient ID: NPC122962

Ingredient ID: NPC120926

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC111888

Ingredient ID: NPC107540

Ingredient ID: NPC105246

Ingredient ID: NPC104631

Ingredient ID: NPC102266

Ingredient ID: NPC100380