• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Aquilaria Sinensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTTCCGTAGGTGACTGCGGAAGGATCATTGTCGATTCCTGCACAGCAGCATGACCCGTGAACGTTAATAACAATGTGCCGAGTTGGAATTGTGTCGTTATGCCCCATTCCCTCTTCGGTTGGCCCTTGTGGCCGTCATAACCAAACCCCGGCGCGGACTGTGCCAAGGAACTTGATCACATAATACGTTTGCCTCGTGCACCCAGAAATGGGAGCGGTGGGGATCAAGCGTTGAAACGAATCTAAAATGACTCCCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTTGGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATTGTAGCCCCCCACCCTCGTCGTAATGTCTGTGAGGGCTGTGTGGGGCTGATACTGGCCTTCCCGTATGCACAGCAATGCGGTTGGCCCAAATGGAGGAACCCAGGGCGGTGTATGCCATGATGAACGGTGGTGTGTGCTTAGCCTGCCGTCGTTAGAGCATCATGCGCATCATGCCCTTGAGGTATGTTTCGTGGACAACCCCGGTGCAATCATAGCGCGCA

Click for details-----ITS1

TTTCCGTAGGTGACTGCGGAAGGATCATTGTCGATTCCTGCACAGCAGCATGACCCGTGAACGTTAATAACAATGTGCCGAGTTGGAATTGTGTCGTTATGCCCCATTCCCTCTTCGGTTGGCCCTTGTGGCCGTCATAACCAAACCCCGGCGCGGACTGCGCCAAGGAACTTGATCACATAATACGTTTGCCTCATGCACCCAGAAATGGGGGCGGTGGGGATCAAGCGTTGAAACGAATCTAAAA

Click for details-----ITS2

ATTGTAGCCCCCCACCCTCGTCGTAATGTCTGTGAGGGCTGTGTGGGGCTGATACTGGCCTTCCCGTATGCACAGCAATGCGGTTGGCCCAAATGGAGGAACCCAGGGCGGTGTATGCCATGATGAACCGTGGTGTGTGCTTAGCCTGCCGTCGTTAGAGCATCATGSGCATCATGCCCTTGACGTATGTTTCGTGGACAACCCCGGTGCAATCATAGCGCGCA
Taxonomic Information

Plant ID: NPO14558
Plant Latin Name: Aquilaria Sinensis
Taxonomy Genus: Aquilaria
Taxonomy Family: Thymelaeaceae

Plant External Links:

NCBI TaxonomyDB: 210372
Plant-of-the-World-Online: 830849-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

228 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


149 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

93 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98049

Ingredient ID: NPC96624

Ingredient ID: NPC96218

Ingredient ID: NPC94209

Ingredient ID: NPC93433

Ingredient ID: NPC93297

Ingredient ID: NPC93241

Ingredient ID: NPC92478

Ingredient ID: NPC90566

Ingredient ID: NPC9038

Ingredient ID: NPC90232

Ingredient ID: NPC82042

Ingredient ID: NPC81511

Ingredient ID: NPC80068

Ingredient ID: NPC76582

Ingredient ID: NPC7569

Ingredient ID: NPC74998

Ingredient ID: NPC7491

Ingredient ID: NPC74458

Ingredient ID: NPC73803

Ingredient ID: NPC72181

Ingredient ID: NPC71148

Ingredient ID: NPC71074

Ingredient ID: NPC69382

Ingredient ID: NPC67132

Ingredient ID: NPC66577

Ingredient ID: NPC62469

Ingredient ID: NPC61779

Ingredient ID: NPC61530

Ingredient ID: NPC59405

Ingredient ID: NPC58522

Ingredient ID: NPC57801

Ingredient ID: NPC54732

Ingredient ID: NPC54243

Ingredient ID: NPC478388

Ingredient ID: NPC478387

Ingredient ID: NPC478386

Ingredient ID: NPC478385

Ingredient ID: NPC478384

Ingredient ID: NPC478383

Ingredient ID: NPC478382

Ingredient ID: NPC478381

Ingredient ID: NPC478380

Ingredient ID: NPC478379

Ingredient ID: NPC478378

Ingredient ID: NPC478377

Ingredient ID: NPC478376

Ingredient ID: NPC46161

Ingredient ID: NPC45107

Ingredient ID: NPC424

Ingredient ID: NPC42372

Ingredient ID: NPC41476

Ingredient ID: NPC39077

Ingredient ID: NPC39068

Ingredient ID: NPC38790

Ingredient ID: NPC36061

Ingredient ID: NPC35961

Ingredient ID: NPC34440

Ingredient ID: NPC34052

Ingredient ID: NPC328818

Ingredient ID: NPC327127

Ingredient ID: NPC325010

Ingredient ID: NPC322723

Ingredient ID: NPC320452

Ingredient ID: NPC32021

Ingredient ID: NPC3128

Ingredient ID: NPC309954

Ingredient ID: NPC308749

Ingredient ID: NPC30738

Ingredient ID: NPC307216

Ingredient ID: NPC306582

Ingredient ID: NPC306255

Ingredient ID: NPC306120

Ingredient ID: NPC30430

Ingredient ID: NPC301964

Ingredient ID: NPC301585

Ingredient ID: NPC298224

Ingredient ID: NPC296929

Ingredient ID: NPC295613

Ingredient ID: NPC292419

Ingredient ID: NPC292330

Ingredient ID: NPC291428

Ingredient ID: NPC290791

Ingredient ID: NPC289432

Ingredient ID: NPC28913

Ingredient ID: NPC287595

Ingredient ID: NPC286570

Ingredient ID: NPC284277

Ingredient ID: NPC284034

Ingredient ID: NPC280789

Ingredient ID: NPC280248

Ingredient ID: NPC279404

Ingredient ID: NPC279026

Ingredient ID: NPC278683

Ingredient ID: NPC277493

Ingredient ID: NPC27226

Ingredient ID: NPC267812

Ingredient ID: NPC266061

Ingredient ID: NPC263724

Ingredient ID: NPC26229

Ingredient ID: NPC261831

Ingredient ID: NPC261080

Ingredient ID: NPC260731

Ingredient ID: NPC260397

Ingredient ID: NPC256551

Ingredient ID: NPC253509

Ingredient ID: NPC253204

Ingredient ID: NPC252821

Ingredient ID: NPC252691

Ingredient ID: NPC251857

Ingredient ID: NPC2499

Ingredient ID: NPC249891

Ingredient ID: NPC248355

Ingredient ID: NPC246543

Ingredient ID: NPC246238

Ingredient ID: NPC246080

Ingredient ID: NPC244968

Ingredient ID: NPC243047

Ingredient ID: NPC242585

Ingredient ID: NPC242491

Ingredient ID: NPC24124

Ingredient ID: NPC241110

Ingredient ID: NPC239113

Ingredient ID: NPC23851

Ingredient ID: NPC238273

Ingredient ID: NPC236579

Ingredient ID: NPC236517

Ingredient ID: NPC23552

Ingredient ID: NPC23537

Ingredient ID: NPC235251

Ingredient ID: NPC234231

Ingredient ID: NPC234133

Ingredient ID: NPC232957

Ingredient ID: NPC232654

Ingredient ID: NPC231773

Ingredient ID: NPC230329

Ingredient ID: NPC230301

Ingredient ID: NPC229403

Ingredient ID: NPC227211

Ingredient ID: NPC227172

Ingredient ID: NPC223455

Ingredient ID: NPC221825

Ingredient ID: NPC219960

Ingredient ID: NPC218636

Ingredient ID: NPC217191

Ingredient ID: NPC217119

Ingredient ID: NPC216630

Ingredient ID: NPC216127

Ingredient ID: NPC214067

Ingredient ID: NPC213842

Ingredient ID: NPC213536

Ingredient ID: NPC213082

Ingredient ID: NPC211762

Ingredient ID: NPC209971

Ingredient ID: NPC209961

Ingredient ID: NPC209504

Ingredient ID: NPC207844

Ingredient ID: NPC204932

Ingredient ID: NPC203719

Ingredient ID: NPC201704

Ingredient ID: NPC200461

Ingredient ID: NPC2

Ingredient ID: NPC196924

Ingredient ID: NPC196776

Ingredient ID: NPC195749

Ingredient ID: NPC194856

Ingredient ID: NPC192977

Ingredient ID: NPC192962

Ingredient ID: NPC192810

Ingredient ID: NPC187234

Ingredient ID: NPC187021

Ingredient ID: NPC186220

Ingredient ID: NPC185290

Ingredient ID: NPC183999

Ingredient ID: NPC183192

Ingredient ID: NPC183067

Ingredient ID: NPC182117

Ingredient ID: NPC182045

Ingredient ID: NPC179024

Ingredient ID: NPC176589

Ingredient ID: NPC173658

Ingredient ID: NPC171294

Ingredient ID: NPC163707

Ingredient ID: NPC163649

Ingredient ID: NPC16157

Ingredient ID: NPC156252

Ingredient ID: NPC155185

Ingredient ID: NPC154186

Ingredient ID: NPC153958

Ingredient ID: NPC153508

Ingredient ID: NPC153053

Ingredient ID: NPC151613

Ingredient ID: NPC150021

Ingredient ID: NPC147954

Ingredient ID: NPC146197

Ingredient ID: NPC145879

Ingredient ID: NPC143799

Ingredient ID: NPC142900

Ingredient ID: NPC142753

Ingredient ID: NPC141765

Ingredient ID: NPC14142

Ingredient ID: NPC139102

Ingredient ID: NPC138932

Ingredient ID: NPC13789

Ingredient ID: NPC135648

Ingredient ID: NPC135388

Ingredient ID: NPC131882

Ingredient ID: NPC131192

Ingredient ID: NPC129827

Ingredient ID: NPC129489

Ingredient ID: NPC128575

Ingredient ID: NPC128186

Ingredient ID: NPC128061

Ingredient ID: NPC127343

Ingredient ID: NPC125737

Ingredient ID: NPC125191

Ingredient ID: NPC11520

Ingredient ID: NPC114764

Ingredient ID: NPC111326

Ingredient ID: NPC108406

Ingredient ID: NPC107987

Ingredient ID: NPC106250

Ingredient ID: NPC104569

Ingredient ID: NPC10251

Ingredient ID: NPC101285

Ingredient ID: NPC10068

Ingredient ID: NPC100665

Ingredient ID: NPC100267