CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Ilex Rotunda

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGATGCCTGCAAAGTAGACCCGGCGAACTCGTTAAAATATGCGTGGGGGTTTGAGAAGGGGTGCGCGAGCCCCCCCGACACATTCCCCCACCCCCCGGGACTTGGCCCGGGTTCCCCTTGCGGGGACTCGGCCAAGGCTCCCGACAACGAACCCCGGCGCTGTCTGCGCCAAGGAACCTTAACCGAAGAGCTGGCCCCCCGRTGTCCCGTTCGCGGTGTGCACGGGAGGCGTACGCATCTTTCGAATCTAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCCCAACCCCGACAATGCCCGGCTGGCAGCCGGATATTGCGGGAGTTGCGGGCGGAGATTGGCCTCCCGTCCACGACCGTGCACGGTTGGCCCAAAAAGCGAGTTCTTGACGACGGACGTCACGACGAGTGGTGGTTGGAAGACCTCTTGCGTCGAGTCGTGAGGCACCCGAGTCTGTAACGAGCTCTGACCGCGACCCTGTGCGCCTTCCTTAGGGGGCGGCGCTCCGA

Click for details-----ITS1

TTGTCGATGCCTGCAAAGTANACCCGGCGAACTCGTTAAAATATGCGTGGGGGTTTGAGAAGGGGCGCGCGAGCCCCCCCGACACACTCCCCCACCCCCCGGGACTTGGCCCGGGTTCCCCTTGCGGGGACTCGGCCAAGGCTCCCGACAACGAACTCCGGCGCTGTCTGCGCCAAGGAACCTTAACCGAAGAGCTGGCCCCCCGGTGTCCCGTTCGCGGTGTGCACGGGAGGCATACGCATCTTTCGAATCTAAAA

Click for details-----ITS2

ATCACGTCGCCCCCAACCCCGACAATGCCCGGCTGGCAGCCGGATATTGCGGGAGTTGCGGGCGGAGATTGGCCTCCCGTCCACGACCGTGCGCGGTTGGCCCAAAAAGCGAGTTCTTGACGACGGACGTCACGACGAGTGGTGGTTGGAAGACCTCTTGCGTCGAGTCGTGAGGCACCCGAGTCTGTAACGAGCTCTGACCGCGACCCTGTGCGCCTTCCTTAGGGGGCGGCGCTCCGACCGCGACCCCAGGTCAGACGGGATTA

Taxonomic Information

Plant ID: NPO14548
Plant Latin Name: Ilex Rotunda
Taxonomy Genus: Ilex
Taxonomy Family: Aquifoliaceae

Plant External Links:

NCBI TaxonomyDB: 53211
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

15 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

9 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

6 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC93201

Ingredient ID: NPC836

Ingredient ID: NPC49074

Ingredient ID: NPC37739

Ingredient ID: NPC32298

Ingredient ID: NPC284121

Ingredient ID: NPC248394

Ingredient ID: NPC240829

Ingredient ID: NPC210478

Ingredient ID: NPC197752

Ingredient ID: NPC154069

Ingredient ID: NPC114159

Ingredient ID: NPC113961

Ingredient ID: NPC106827

Ingredient ID: NPC100980

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Therapeutic Target	Serine protease	DPP4	Dipeptidyl peptidase IV	P27487	CHEMBL284
Therapeutic Target	Transcription factor	TP53	Cellular tumor antigen p53	P04637	CHEMBL4096
Therapeutic Target	Transferase	TNKS	Tankyrase-1	O95271	CHEMBL6164
Therapeutic Target	Transferase	TNKS2	Tankyrase-2	Q9H2K2	CHEMBL6154

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	5

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00966836	Prevention of Transplant Atherosclerosis With Everolimus and Anti-cytomegalovirus Therapy	cytomegalovirus infection	Phenol (NPC100980)	NP level
NCT01468415	Efficiency Comparison Between Methylprednisolone and Phenol 8% Treatment Using a Trans Sacral Approach - on Lower Back Pain and Limbs	Back pain	Phenol (NPC100980)	NP level
NCT01015521	Efficacy Study of Aminoflavone Prodrug to Treat Breast Cancer	breast neoplasm	Flavone (NPC32298)	NP level
NCT01197040	Evaluation of Low Dose Corticosteroids Efficiency, Associated With Myfortic ® in the Treatment of Nephrotic Syndrome	nephrotic syndrome	Phenol (NPC100980)	NP level
NCT01989897	Effect of HSA or Saline Diluent on Immunotherapy Extract Stability as Determined by Graded ID Skin Tests	allergic rhinitis	Phenol (NPC100980)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	TNKS2,TP53,TNKS
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	DPP4,CYP1B1,GABRA6
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	TP53,DPP4
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	TP53,DPP4
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	TP53,DPP4
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	DPP4,CYP1B1
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	DPP4,CYP1B1
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	DPP4,CYP1B1
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	DPP4,CYP1B1
Kidney failure Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB60-GB6Z	TP53
Bladder cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	TP53
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	TP53
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	DPP4
Ovarian dysfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80	TP53
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	DPP4
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	TP53
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	DPP4
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	DPP4
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	TP53
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	TP53
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	DPP4
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	TP53
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	TP53
Liposarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B59	TP53
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	DPP4
Lip/oral cavity/pharynx neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6E	TP53
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	TP53
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	DPP4
Esophageal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	TP53
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	TP53
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	TP53
Fallopian tube cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C74	TP53
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	TP53
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	TP53
Metastatic liver/bile duct neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D80	TP53
Cervical cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C77	TP53
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	TP53
Vasomotor/allergic rhinitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA08	NCT01989897
Nephritic syndrome Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB40	NCT01197040
Spinal pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: ME84	NCT01468415
Congenital cytomegalovirus infection Disease Category: 19.Certain conditions originating in the perinatal period Disease ICD-11 Code: KA62.3	NCT00966836
Neoplasms of unknown behaviour of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F95	NCT01015521
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	TP53
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	TP53
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	DPP4
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	TP53
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	DPP4
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	DPP4
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	DPP4
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	DPP4
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CYP1B1
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	DPP4
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	DPP4

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Ilex Rotunda

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

15 All known Ingredients in Total

9 Ingredients with Acceptable Bioavailablity

6 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Ovarian cancer

Malignant neoplasms of thyroid gland, unspecified

Chronic arterial occlusive disease

Malignant haematopoietic neoplasm

Carcinosarcoma of uterus

Adenocarcinoma of pancreas

Malignant neoplasms of thymus

Glioblastoma of brain

Carpal tunnel syndrome

Kidney failure

Bladder cancer

Colorectal cancer

Psoriasis

Ovarian dysfunction

Metabolic disorder

Brain cancer

Acute diabete complication

Diabetes mellitus, type unspecified

Acute myeloid leukaemia

Pancreatic cancer

Autism spectrum disorder

Stomach cancer

Endometrial cancer

Liposarcoma

Type 2 diabetes mellitus

Lip/oral cavity/pharynx neoplasm

Mature B-cell leukaemia

Myocardial infarction

Esophageal cancer

Peritoneal cancer

Transplant rejection

Fallopian tube cancer

Myelodysplastic syndrome

Head and neck cancer

Metastatic liver/bile duct neoplasm

Cervical cancer

Solid tumour/cancer

Vasomotor/allergic rhinitis

Nephritic syndrome

Spinal pain

Congenital cytomegalovirus infection

Neoplasms of unknown behaviour of breast

Serous cystadenoma,borderline malignancy of ovary

Malignant neoplasms of biliary tract, distal bile duct

Leishmaniasis

Diffuse large B-cell lymphomas

West Nile virus infection

Mesothelioma of pleura

Pneumonia due to Pseudomonasaeruginosa

Superficial ovarian endometriosis

Heart failure, unspecified

Germ cell tumour of testis

Malignant neoplasms of adrenal gland

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities