• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Swertia Pseudochinensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCCAATCCTGCCAAGCATACGACCCGAGAACATGTTTAACAAACGGCCGTCAGGGACGAGGGAAACCACGGACCGGCGCCCCGAGCACGGCGTCGACCTTAGGTCGCTCGTCGTGCACACAAACAACCCCGGGCGCATAAAAGCGCCAAGGAAAACATGAAAGGGATGGCTTGCCTCCTGACGCTCCGTTCGCGGAGCGCACGGGAGGGCAACAGGCACCTAAAGAAACAAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO14381
Plant Latin Name: Swertia Pseudochinensis
Taxonomy Genus: Swertia
Taxonomy Family: Gentianaceae

Plant External Links:

NCBI TaxonomyDB: 676131
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

99 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


33 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

26 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC93845

Ingredient ID: NPC92117

Ingredient ID: NPC8214

Ingredient ID: NPC75573

Ingredient ID: NPC74881

Ingredient ID: NPC71556

Ingredient ID: NPC66221

Ingredient ID: NPC64156

Ingredient ID: NPC62806

Ingredient ID: NPC62496

Ingredient ID: NPC62042

Ingredient ID: NPC60175

Ingredient ID: NPC59870

Ingredient ID: NPC53545

Ingredient ID: NPC51443

Ingredient ID: NPC45136

Ingredient ID: NPC4460

Ingredient ID: NPC40943

Ingredient ID: NPC35554

Ingredient ID: NPC325325

Ingredient ID: NPC315566

Ingredient ID: NPC313116

Ingredient ID: NPC307699

Ingredient ID: NPC299923

Ingredient ID: NPC299144

Ingredient ID: NPC29565

Ingredient ID: NPC295146

Ingredient ID: NPC289774

Ingredient ID: NPC287020

Ingredient ID: NPC286818

Ingredient ID: NPC282661

Ingredient ID: NPC278976

Ingredient ID: NPC27636

Ingredient ID: NPC276164

Ingredient ID: NPC276115

Ingredient ID: NPC272343

Ingredient ID: NPC271870

Ingredient ID: NPC268342

Ingredient ID: NPC266613

Ingredient ID: NPC264972

Ingredient ID: NPC263398

Ingredient ID: NPC260895

Ingredient ID: NPC256572

Ingredient ID: NPC252155

Ingredient ID: NPC246162

Ingredient ID: NPC246044

Ingredient ID: NPC244793

Ingredient ID: NPC242529

Ingredient ID: NPC229745

Ingredient ID: NPC228383

Ingredient ID: NPC22691

Ingredient ID: NPC222193

Ingredient ID: NPC220157

Ingredient ID: NPC219876

Ingredient ID: NPC215291

Ingredient ID: NPC211985

Ingredient ID: NPC210843

Ingredient ID: NPC209907

Ingredient ID: NPC209544

Ingredient ID: NPC199927

Ingredient ID: NPC199100

Ingredient ID: NPC194109

Ingredient ID: NPC1940

Ingredient ID: NPC188762

Ingredient ID: NPC188167

Ingredient ID: NPC18270

Ingredient ID: NPC181953

Ingredient ID: NPC17928

Ingredient ID: NPC177986

Ingredient ID: NPC177573

Ingredient ID: NPC177061

Ingredient ID: NPC17129

Ingredient ID: NPC170204

Ingredient ID: NPC168377

Ingredient ID: NPC167520

Ingredient ID: NPC166264

Ingredient ID: NPC16496

Ingredient ID: NPC162656

Ingredient ID: NPC161881

Ingredient ID: NPC1612

Ingredient ID: NPC158587

Ingredient ID: NPC154771

Ingredient ID: NPC148834

Ingredient ID: NPC140310

Ingredient ID: NPC139608

Ingredient ID: NPC138469

Ingredient ID: NPC138287

Ingredient ID: NPC132193

Ingredient ID: NPC130683

Ingredient ID: NPC126029

Ingredient ID: NPC123052

Ingredient ID: NPC115323

Ingredient ID: NPC114308

Ingredient ID: NPC110899

Ingredient ID: NPC110838

Ingredient ID: NPC10941

Ingredient ID: NPC10807

Ingredient ID: NPC10269

Ingredient ID: NPC101051