• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Hypericum Hirsutum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTCCAAATGACCCGCGAACCAGTTATCCACAAGTGGGGGTGTCGGGGCTTCGTCCTGGCGCCCCCGTTCGGGTGGTGGTCAGGCGCGCCAAGCTCTTGGCACGGCTGTTCCATCACCTGCCCAACAAACAAACCCCGGCGCGGCACGCGCCAAGGAACTTTTGCAATATAAGAAGGATCACGCTCCCGGCCGTGCCGGAAATCGGACAACGCGGTCGGGGGCTTCCTTCTATTCATAACAATAACGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGCCTGCCTGGGTGTCACACATCGTCGCCCCCCAAAATCCGATCTCTCGCAAGGGACGATCGGGAAGAGGATGGGCGGAAAATGGTCTCCCGTGCGCTCCCGTTCGCGGTTGGCCCAAAAATGAGTTCCTGGCAAAGCAAAGCCACGACCAGCGGTGGTTTGTAAGACCCTCGGTACAAGTCGTGACGCCTTGCGTTGCGAATACGGACATGTTGACCCTGAACGTGATCGAGTAACTTCGAACGCTCACAAA

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO14367
Plant Latin Name: Hypericum Hirsutum
Taxonomy Genus: Hypericum
Taxonomy Family: Hypericaceae

Plant External Links:

NCBI TaxonomyDB: 673928
Plant-of-the-World-Online: 433492-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

Canada; Turkey; Italy; France; Ireland; Norway; Belarus; Iran; Algeria; China; Belgium; Germany; Kazakhstan; Spain; Ukraine; Netherlands; Denmark; Poland; Finland; Sweden; Switzerland; Russia; Bulgaria; Romania; Albania; United Kingdom; Austria; Greece

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

8 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


6 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

7 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC294852

Ingredient ID: NPC241498

Ingredient ID: NPC235260

Ingredient ID: NPC231772

Ingredient ID: NPC169749

Ingredient ID: NPC160951

Ingredient ID: NPC159020

Ingredient ID: NPC156654