• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Houttuynia Cordata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CTGCGGAAGGATCATTGTTGATGCGTACCAAAACAAGATCGACCGAAGCGAACATGTGACCCCTTGTTCTTTGCTTGCGTGCGAGGATTGCCATCTCGGTGGCTCTCCGAGCGCGTCGGGCACCAACGAACAAAATCCCGGCGCAGTTCGCGCCAAGGAATTTTCTTAATTGATTGTGGCGGTCTCGTCGCCCGTTTGCGCCTCGTGCGTCGGCGGGTGCGAGTCGGCGCATCAAACTATAATGTCAATACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTTTAGGTTGAGGGCACATCTGCTTGGGCGTCAAACATCACGTCGCTCCCCACACCACTGCCCAACGGGCAGACAAGGATGGGTCTGCGGAGATTGGTCGTCCGAGTGCCTCGAGCATGCGGTTGGCTGAAAAGCTCTGGCCTTTGGTTGCACGCGGCTCAACAAGTGGTGGTTGTGGGCTCTTTTGGGCCGCGATTGTCGGGATGTTGTGTCGTGTTTTGCCCGTGTTGGCCAGCGAGGACCCTATTCGATCGACCTCCGCACTCCGGAGGCACGAATCAGATTGCGACCCCAAGTCAGGTGGGATCA

Click for details-----ITS1

CTGCGGAAGGATCATTGTTGATGCGTACCAAAACAAGATCGACCGAAGCGAACATGTGACCCCTTGTTCTTTGCTTGCGTGCGAGGATTGCCATCTCGGTGGCTCTCCGAGCGCGTCGGGCACCAACGAACAAAATCCCGGCGCAGTTCGCGCCAAGGAATTTTCTTAATTGATTGTGGCGGTCTCGTCGCCCGTTTGCGCCTCGTGCGTCGGCGGGTGCGAGTCGGCGCATCAAACTATAATGTCAATA

Click for details-----ITS2

ATCACGTCGCTCCCCACACCACTGCCCAACGGGCAGACAAGGATGGGTCTGCGGAGATTGGTCGTCCGAGTGCCTCGAGCATGCGGTTGGCTGAAAAGCTCTGGCCTTTGGTTGCACGCGGCTCAACAAGTGGTGGTTGTGGGCTCTTTTGGGCCGCGATTGTCGGGATGTTGTGTCGTGTTTTGCCCGTGTTGGCCAGCGAGGACCCTATTCGATCGACCTCCGCACTCCGGAGGCACGAATCAGATTGCGACCCCAAGTCAGGTGGGATCA
Taxonomic Information

Plant ID: NPO1436
Plant Latin Name: Houttuynia Cordata
Taxonomy Genus: Houttuynia
Taxonomy Family: Saururaceae

Plant External Links:

NCBI TaxonomyDB: 16752
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Thailand; China; India; Laos

Traditional Medicine System:
Indian Folk; TCM; Kampo


Medicinal Functions:

Antibacterial; Antidote; Antiinflammatory; Antiphlogistic; Antiviral; Astringent; Depurative; Diuretic; Emmenagogue; Febrifuge; Hypoglycaemic; Laxative; Ophthalmic; Women's complaints

Geographical Distribution

India; China; Thailand; Laos

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

327 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


251 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

162 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99480

Ingredient ID: NPC9880

Ingredient ID: NPC97453

Ingredient ID: NPC96630

Ingredient ID: NPC96603

Ingredient ID: NPC94196

Ingredient ID: NPC93527

Ingredient ID: NPC92774

Ingredient ID: NPC89069

Ingredient ID: NPC88846

Ingredient ID: NPC88789

Ingredient ID: NPC88759

Ingredient ID: NPC88566

Ingredient ID: NPC87828

Ingredient ID: NPC85813

Ingredient ID: NPC84811

Ingredient ID: NPC83692

Ingredient ID: NPC82648

Ingredient ID: NPC81933

Ingredient ID: NPC81808

Ingredient ID: NPC81775

Ingredient ID: NPC79887

Ingredient ID: NPC79714

Ingredient ID: NPC78551

Ingredient ID: NPC76336

Ingredient ID: NPC76145

Ingredient ID: NPC7568

Ingredient ID: NPC75158

Ingredient ID: NPC7491

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC70334

Ingredient ID: NPC70186

Ingredient ID: NPC69750

Ingredient ID: NPC68889

Ingredient ID: NPC68873

Ingredient ID: NPC68670

Ingredient ID: NPC67986

Ingredient ID: NPC65987

Ingredient ID: NPC65916

Ingredient ID: NPC64946

Ingredient ID: NPC64943

Ingredient ID: NPC64176

Ingredient ID: NPC63827

Ingredient ID: NPC63121

Ingredient ID: NPC62086

Ingredient ID: NPC61477

Ingredient ID: NPC60556

Ingredient ID: NPC60288

Ingredient ID: NPC58478

Ingredient ID: NPC57897

Ingredient ID: NPC57788

Ingredient ID: NPC57565

Ingredient ID: NPC57069

Ingredient ID: NPC54980

Ingredient ID: NPC54264

Ingredient ID: NPC54235

Ingredient ID: NPC5402

Ingredient ID: NPC52230

Ingredient ID: NPC51758

Ingredient ID: NPC4962

Ingredient ID: NPC49615

Ingredient ID: NPC49151

Ingredient ID: NPC49074

Ingredient ID: NPC48900

Ingredient ID: NPC48638

Ingredient ID: NPC482920

Ingredient ID: NPC47946

Ingredient ID: NPC45727

Ingredient ID: NPC45540

Ingredient ID: NPC44751

Ingredient ID: NPC42403

Ingredient ID: NPC40249

Ingredient ID: NPC40030

Ingredient ID: NPC39633

Ingredient ID: NPC38751

Ingredient ID: NPC3857

Ingredient ID: NPC3824

Ingredient ID: NPC3694

Ingredient ID: NPC3649

Ingredient ID: NPC35410

Ingredient ID: NPC34764

Ingredient ID: NPC329121

Ingredient ID: NPC326143

Ingredient ID: NPC32279

Ingredient ID: NPC320649

Ingredient ID: NPC320283

Ingredient ID: NPC318533

Ingredient ID: NPC317489

Ingredient ID: NPC317111

Ingredient ID: NPC3155

Ingredient ID: NPC312132

Ingredient ID: NPC311936

Ingredient ID: NPC309606

Ingredient ID: NPC309182

Ingredient ID: NPC308943

Ingredient ID: NPC308218

Ingredient ID: NPC306990

Ingredient ID: NPC306207

Ingredient ID: NPC305660

Ingredient ID: NPC305219

Ingredient ID: NPC302857

Ingredient ID: NPC301919

Ingredient ID: NPC301585

Ingredient ID: NPC299937

Ingredient ID: NPC296337

Ingredient ID: NPC296256

Ingredient ID: NPC295927

Ingredient ID: NPC29561

Ingredient ID: NPC294902

Ingredient ID: NPC293746

Ingredient ID: NPC289827

Ingredient ID: NPC288932

Ingredient ID: NPC288779

Ingredient ID: NPC288423

Ingredient ID: NPC287660

Ingredient ID: NPC287503

Ingredient ID: NPC287297

Ingredient ID: NPC285554

Ingredient ID: NPC285532

Ingredient ID: NPC284731

Ingredient ID: NPC284078

Ingredient ID: NPC283786

Ingredient ID: NPC283655

Ingredient ID: NPC283013

Ingredient ID: NPC282055

Ingredient ID: NPC281131

Ingredient ID: NPC279473

Ingredient ID: NPC279026

Ingredient ID: NPC278683

Ingredient ID: NPC278077

Ingredient ID: NPC275463

Ingredient ID: NPC275011

Ingredient ID: NPC273390

Ingredient ID: NPC271270

Ingredient ID: NPC26974

Ingredient ID: NPC26960

Ingredient ID: NPC26906

Ingredient ID: NPC268862

Ingredient ID: NPC266539

Ingredient ID: NPC266129

Ingredient ID: NPC26600

Ingredient ID: NPC265988

Ingredient ID: NPC265383

Ingredient ID: NPC263334

Ingredient ID: NPC262911

Ingredient ID: NPC262505

Ingredient ID: NPC262094

Ingredient ID: NPC261991

Ingredient ID: NPC261619

Ingredient ID: NPC261080

Ingredient ID: NPC260842

Ingredient ID: NPC260381

Ingredient ID: NPC259512

Ingredient ID: NPC258492

Ingredient ID: NPC258136

Ingredient ID: NPC256848

Ingredient ID: NPC25495

Ingredient ID: NPC254713

Ingredient ID: NPC252558

Ingredient ID: NPC251065

Ingredient ID: NPC250194

Ingredient ID: NPC249281

Ingredient ID: NPC248726

Ingredient ID: NPC248411

Ingredient ID: NPC247223

Ingredient ID: NPC246165

Ingredient ID: NPC24506

Ingredient ID: NPC241846

Ingredient ID: NPC241784

Ingredient ID: NPC241721

Ingredient ID: NPC240575

Ingredient ID: NPC239406

Ingredient ID: NPC239039

Ingredient ID: NPC236797

Ingredient ID: NPC236202

Ingredient ID: NPC235251

Ingredient ID: NPC233533

Ingredient ID: NPC232375

Ingredient ID: NPC231738

Ingredient ID: NPC230242

Ingredient ID: NPC229387

Ingredient ID: NPC227986

Ingredient ID: NPC227670

Ingredient ID: NPC227378

Ingredient ID: NPC225783

Ingredient ID: NPC223697

Ingredient ID: NPC222997

Ingredient ID: NPC222561

Ingredient ID: NPC22229

Ingredient ID: NPC222001

Ingredient ID: NPC22098

Ingredient ID: NPC218266

Ingredient ID: NPC218109

Ingredient ID: NPC216630

Ingredient ID: NPC216127

Ingredient ID: NPC215632

Ingredient ID: NPC214584

Ingredient ID: NPC213918

Ingredient ID: NPC213749

Ingredient ID: NPC209970

Ingredient ID: NPC209846

Ingredient ID: NPC209275

Ingredient ID: NPC208112

Ingredient ID: NPC20791

Ingredient ID: NPC20742

Ingredient ID: NPC20674

Ingredient ID: NPC205003

Ingredient ID: NPC204596

Ingredient ID: NPC202742

Ingredient ID: NPC202245

Ingredient ID: NPC201844

Ingredient ID: NPC201705

Ingredient ID: NPC201622

Ingredient ID: NPC201562

Ingredient ID: NPC200210

Ingredient ID: NPC199117

Ingredient ID: NPC198658

Ingredient ID: NPC197396

Ingredient ID: NPC197356

Ingredient ID: NPC196490

Ingredient ID: NPC196434

Ingredient ID: NPC196167

Ingredient ID: NPC194078

Ingredient ID: NPC19319

Ingredient ID: NPC193062

Ingredient ID: NPC192538

Ingredient ID: NPC190810

Ingredient ID: NPC189036

Ingredient ID: NPC188238

Ingredient ID: NPC18772

Ingredient ID: NPC186793

Ingredient ID: NPC186653

Ingredient ID: NPC186584

Ingredient ID: NPC185189

Ingredient ID: NPC18507

Ingredient ID: NPC184831

Ingredient ID: NPC184078

Ingredient ID: NPC184049

Ingredient ID: NPC182102

Ingredient ID: NPC18205

Ingredient ID: NPC180871

Ingredient ID: NPC180684

Ingredient ID: NPC179950

Ingredient ID: NPC179831

Ingredient ID: NPC179103

Ingredient ID: NPC178223

Ingredient ID: NPC177197

Ingredient ID: NPC177112

Ingredient ID: NPC176740

Ingredient ID: NPC175987

Ingredient ID: NPC173996

Ingredient ID: NPC173638

Ingredient ID: NPC173637

Ingredient ID: NPC173100

Ingredient ID: NPC170526

Ingredient ID: NPC167976

Ingredient ID: NPC167385

Ingredient ID: NPC166894

Ingredient ID: NPC166362

Ingredient ID: NPC164568

Ingredient ID: NPC16157

Ingredient ID: NPC161097

Ingredient ID: NPC160590

Ingredient ID: NPC160416

Ingredient ID: NPC159747

Ingredient ID: NPC158306

Ingredient ID: NPC155182

Ingredient ID: NPC153439

Ingredient ID: NPC152655

Ingredient ID: NPC150783

Ingredient ID: NPC148303

Ingredient ID: NPC14682

Ingredient ID: NPC146703

Ingredient ID: NPC146522

Ingredient ID: NPC145590

Ingredient ID: NPC145373

Ingredient ID: NPC145038

Ingredient ID: NPC143639

Ingredient ID: NPC142703

Ingredient ID: NPC14227

Ingredient ID: NPC141777

Ingredient ID: NPC13991

Ingredient ID: NPC139569

Ingredient ID: NPC138782

Ingredient ID: NPC138347

Ingredient ID: NPC138113

Ingredient ID: NPC13789

Ingredient ID: NPC135353

Ingredient ID: NPC135257

Ingredient ID: NPC135088

Ingredient ID: NPC131981

Ingredient ID: NPC13105

Ingredient ID: NPC130051

Ingredient ID: NPC127878

Ingredient ID: NPC127180

Ingredient ID: NPC126915

Ingredient ID: NPC12664

Ingredient ID: NPC126240

Ingredient ID: NPC125935

Ingredient ID: NPC125886

Ingredient ID: NPC124436

Ingredient ID: NPC124318

Ingredient ID: NPC121373

Ingredient ID: NPC120775

Ingredient ID: NPC120094

Ingredient ID: NPC119579

Ingredient ID: NPC119381

Ingredient ID: NPC117493

Ingredient ID: NPC116775

Ingredient ID: NPC116452

Ingredient ID: NPC11487

Ingredient ID: NPC114239

Ingredient ID: NPC111929

Ingredient ID: NPC109813

Ingredient ID: NPC109625

Ingredient ID: NPC109286

Ingredient ID: NPC108811

Ingredient ID: NPC107122

Ingredient ID: NPC106250

Ingredient ID: NPC104811

Ingredient ID: NPC104195

Ingredient ID: NPC102803

Ingredient ID: NPC10187

Ingredient ID: NPC101820

Ingredient ID: NPC101285

Ingredient ID: NPC100445