• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Trifolium Diffusum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGATGCCTTACATGCAAACCAACACGTGAATCAGTTTGAACACATAGGGCTGGTTTGAGGTGTTCAACACCTCGGCTTGCCTCTGGTTTGGTGGATGATGACTTGTGCGTCCTCCTCTGGGCCAAAACACAAACCCCGGCGCTGAATGCGTCAAGGAATTTAAAATTTGCTCTGAGCGAACCTGCATGGCACCGGAGACGGTTTTCGTGCGGGTTGTGTTCTGACCCATAATATAGAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO14344
Plant Latin Name: Trifolium Diffusum
Taxonomy Genus: Trifolium
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 97020
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

54 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


51 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

21 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC88255

Ingredient ID: NPC84585

Ingredient ID: NPC72184

Ingredient ID: NPC68224

Ingredient ID: NPC65196

Ingredient ID: NPC63599

Ingredient ID: NPC61473

Ingredient ID: NPC60825

Ingredient ID: NPC56386

Ingredient ID: NPC53069

Ingredient ID: NPC51174

Ingredient ID: NPC51129

Ingredient ID: NPC305712

Ingredient ID: NPC293933

Ingredient ID: NPC291419

Ingredient ID: NPC289795

Ingredient ID: NPC281517

Ingredient ID: NPC279292

Ingredient ID: NPC273103

Ingredient ID: NPC260491

Ingredient ID: NPC254262

Ingredient ID: NPC239128

Ingredient ID: NPC22675

Ingredient ID: NPC224526

Ingredient ID: NPC223263

Ingredient ID: NPC212794

Ingredient ID: NPC212452

Ingredient ID: NPC211203

Ingredient ID: NPC210148

Ingredient ID: NPC208104

Ingredient ID: NPC206155

Ingredient ID: NPC202009

Ingredient ID: NPC197459

Ingredient ID: NPC192768

Ingredient ID: NPC190298

Ingredient ID: NPC189960

Ingredient ID: NPC185467

Ingredient ID: NPC179400

Ingredient ID: NPC179007

Ingredient ID: NPC176482

Ingredient ID: NPC165693

Ingredient ID: NPC165395

Ingredient ID: NPC159823

Ingredient ID: NPC159082

Ingredient ID: NPC15848

Ingredient ID: NPC150648

Ingredient ID: NPC142165

Ingredient ID: NPC137074

Ingredient ID: NPC136994

Ingredient ID: NPC123965

Ingredient ID: NPC122172

Ingredient ID: NPC119158

Ingredient ID: NPC111485

Ingredient ID: NPC103904