CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Chrysobalanus Icaco

Example Image

PLANiTS DNA barcode

TCGATACCTCGCCCGCCAGAACGCCCCGAGAACCAGTTGCACGAATGCGAGGGGATCGGGGGGGCCTTGGCCCCCTCATGTCCCCGAAACAACAACCAAACCCCCGGCGCGGGTCGCGCCAAGGAAATCCAATCAGAAGATCGCCGTCCCAGTCCCAGGAAGGGGGTTTGGGGCGGCAGCCCTTCACATCGAACTAATGAAAA

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO14342
Plant Latin Name: Chrysobalanus Icaco
Taxonomy Genus: Chrysobalanus
Taxonomy Family: Chrysobalanaceae

Plant External Links:

NCBI TaxonomyDB: 22978
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

9 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

9 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

4 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC78359

Ingredient ID: NPC70166

Ingredient ID: NPC49603

Ingredient ID: NPC38821

Ingredient ID: NPC3068

Ingredient ID: NPC291145

Ingredient ID: NPC253675

Ingredient ID: NPC152617

Ingredient ID: NPC122319

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	32

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00304629	Long-term Safety and Efficacy of Galantamine in Alzheimer's Disease	Alzheimer disease	Galantamine (NPC78359)	NP level
NCT01039194	Drug-Drug Interaction to Study the Effect of BMS-708163 on Pharmacokinetics (PK) of Galantamine Extended Release (ER)	Alzheimer disease	Galantamine (NPC78359)	NP level
NCT02374567	Pharmacovigilance in Gerontopsychiatric Patients	anxiety;depressive disorder;schizophrenia;Dementia	Galantamine (NPC78359)	NP level
NCT00509067	Use of Galantamine and CDP-choline (Citicoline) to Treat Adults With Schizophrenia	schizophrenia	Galantamine (NPC78359)	NP level
NCT01100775	Effects of Galantamine on Cognition	schizophrenia	Galantamine (NPC78359)	NP level
NCT00814801	An Efficacy and Safety Study of Galantamine for the Treatment of Patients With Alzheimer's Disease	Alzheimer disease	Galantamine (NPC78359)	NP level
NCT00035191	A Placebo-controlled Trial to Evaluate the Safety and Efficacy of Galantamine in the Treatment of Vascular Dementia	vascular dementia	Galantamine (NPC78359)	NP level
NCT02248636	Cholinesterase Inhibitor Discontinuation	Dementia	Galantamine (NPC78359)	NP level
NCT00301574	An Efficacy and Safety Study of Galantamine for the Treatment of Patients With Alzheimer's Disease.	Alzheimer disease	Galantamine (NPC78359)	NP level
NCT00000172	Evaluation of Galantamine in the Treatment of Alzheimer's Disease	Alzheimer disease	Galantamine (NPC78359)	NP level
NCT01548638	Effect of Galantamine on Smoking Abstinence	nicotine dependence	Galantamine (NPC78359)	NP level
NCT01012167	Oxytocin or Galantamine Versus Placebo for the Treatment of Negative Symptoms and Cognitive Impairments in Schizophrenia	schizophrenia	Galantamine (NPC78359)	NP level
NCT00969696	Galantamine Effects on Cognitive Function in Marijuana Users	memory impairment	Galantamine (NPC78359)	NP level
NCT00750529	Alzheimer and Sleep	Alzheimer disease	Galantamine (NPC78359)	NP level
NCT00814658	The Use of Galantamine (Reminyl ER) in Patients With MIXed Dementia: Effects on Cognition and Quality of Life	Dementia	Galantamine (NPC78359)	NP level
NCT00463879	Galantamine for Cognitive Deficits in Schizophrenia	schizophrenia	Galantamine (NPC78359)	NP level
NCT00679627	A Study of Galantamine Used to Treat Patients With Mild to Moderate Alzheimer's Disease	Alzheimer disease	Galantamine (NPC78359)	NP level
NCT01669538	Effect of Galantamine on Short-term Abstinence	nicotine dependence	Galantamine (NPC78359)	NP level
NCT03124355	Vagal Stimulation in POTS	orthostatic hypotension	Galantamine (NPC78359)	NP level
NCT02872857	Subarachnoid Hemorrhage Recovery And Galantamine	subarachnoid hemorrhage	Galantamine (NPC78359)	NP level
NCT01372306	Galantamine Bioequivalence Study of Dr. Reddy's Under Fed Condition	Fish-eye disease	Galantamine (NPC78359)	NP level
NCT01677754	A Study of RO4602522 in Participants With Moderate Severity Alzheimer Disease on Background Alzheimer Disease Therapy	Alzheimer disease	Galantamine (NPC78359)	NP level
NCT00645190	A Randomized, Double-blind, Flexible Dose, Multicenter Study to Evaluate the Effectiveness and Safety of Galantamine IR in Mild to Moderate Alzheimer's Disease	Alzheimer disease	Galantamine (NPC78359)	NP level
NCT02234752	Galantamine and Memantine Combination for Cognitive Impairments in Schizophrenia	schizoaffective disorder;schizophrenia	Galantamine (NPC78359)	NP level
NCT00230997	Safety and Efficacy of Galantamine in Patients With Dementia With Lewy Bodies	Lewy body dementia	Galantamine (NPC78359)	NP level
NCT01417429	Galantamine Effects on Nicotine Responses in Smokers	nicotine dependence	Galantamine (NPC78359)	NP level
NCT02365285	Racial Differences in Vagal Control of Glucose Homeostasis	obesity	Galantamine (NPC78359)	NP level
NCT00082602	Safety and Tolerability Study of Extended Release (ER) Galantamine in Alzheimer's Disease	Alzheimer disease	Galantamine (NPC78359)	NP level
NCT00252603	Galantamine Versus Placebo in Childhood Autism	autism	Galantamine (NPC78359)	NP level
NCT00809835	Galantamine to Enhance Cognitive Behavioral Therapy for Cocaine Abuse	cocaine dependence	Galantamine (NPC78359)	NP level
NCT03384784	Effect of Galantamine on Inflammation and Cognition	HIV infection	Galantamine (NPC78359)	NP level
NCT00309725	A Cardiac Safety Study of Galantamine in the Treatment of Alzheimer's Disease.	Alzheimer disease	Galantamine (NPC78359)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	NCT02374567,NCT00509067,NCT02234752,NCT01012167,NCT00463879,NCT01100775
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE NCT00814658,NCT02248636,NCT00230997,NCT02374567
Nicotine use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C4A	NCT01417429,NCT01669538,NCT01548638
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ACHE,BCHE
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	BCHE,ACHE
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	BCHE,ACHE
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	BCHE,ACHE
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	BCHE,ACHE
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	BCHE,ACHE
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	BCHE,ACHE NCT00750529,NCT00082602,NCT00000172,NCT00679627,NCT00309725,NCT00645190,NCT01039194,NCT00304629,NCT00814801,NCT00301574,NCT01677754
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Tonus and reflex abnormality Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB47	BCHE
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	ACHE
Eexposure to noxious substances harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE61	BCHE
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	ACHE
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	NCT02365285
Subarachnoid haemorrhage Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B01	NCT02872857
Depressive disorders, unspecified Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A7Z	NCT02374567
Human immunodeficiency virus disease without mention of associated disease or condition, clinical stage unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62.Z	NCT03384784
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	NCT00252603
Orthostatic hypotension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA21	NCT03124355
Anxiety Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB24.3	NCT02374567
Dementia due to cerebrovascular disease Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D81	NCT00035191
Cocaine use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C45	NCT00809835
Hypoalphalipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C81.0	NCT01372306
Schizoaffective disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A21	NCT02234752
Age-associated cognitive decline Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB21.0	NCT00969696
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	BCHE
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	ACHE
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	ACHE
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	BCHE
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	ACHE
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	ACHE
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	ACHE
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ACHE
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	ACHE
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	ACHE
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	BCHE

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Chrysobalanus Icaco

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

9 All known Ingredients in Total

9 Ingredients with Acceptable Bioavailablity

4 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Schizophrenia

Dementia

Nicotine use disorder

Pain, unspecified

Mild neurocognitive disorder

Pheochromocytoma

Other specified malignant neoplasms of kidney, except renal pelvis

Adenocarcinoma of pancreas

Germ cell tumour of testis

Alzheimer disease

Unspecific substance harmful effect

Substance abuse

Tonus and reflex abnormality

Glaucoma

Eexposure to noxious substances harmful effect

Oesophageal/gastroduodenal disorder

Pediculosis

Myasthenia gravis

Parasitic worm infestation

Parkinsonism

Obesity

Subarachnoid haemorrhage

Depressive disorders, unspecified

Human immunodeficiency virus disease without mention of associated disease or condition, clinical stage unspecified

Autism spectrum disorder

Orthostatic hypotension

Anxiety

Dementia due to cerebrovascular disease

Cocaine use disorder

Hypoalphalipoproteinaemia

Schizoaffective disorder

Age-associated cognitive decline

Zika virus disease

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Diffuse large B-cell lymphomas

West Nile virus infection

Mesothelioma of pleura

Superficial ovarian endometriosis

Malignant neoplasms of oesophagus

Cytomegaloviral disease

Systemic lupus erythematosus

Adenocarcinoma of bronchus or lung

Malignant neoplasms of thymus

Ebola virus disease

Malignant neoplasms of adrenal gland

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities