• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ophiorrhiza Kuroiwae


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCAAAGCAGATGACCGCGAACTTGTACAACGTTCGAGAATCGGGAGGGGCGAGAAATCGCTTTTTTCGATTCTCACCGCATCCAATTTGGCTTGCGAAAACAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTTGAACTGATTGCCCGTGCCTCGTTGCCCCGTTCGCGGTGTGCTCGCGAGGTGCTGTGGCGTCTAAACGGACCAAAACGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGATGCCATTAGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCACGGCCGCCATATTCTTGTCGACGGGTGACGGAAATTGGCCTCCCGTGCCGCAAGGTGCGGTTGGCCTAAATGCGATTCCTTAGCTGGGGATGTCACGACAAGTGGTGGTTGAATTACTCAACTCGCGTGTTGTCGCGCCAGTACCCTTAGCGAGATTATTTTGACCCTCGAGCCTGAGTTATCTCAGGCCCTCGA

Click for details-----ITS1

TCGAATCCTGCAAAGCAGATGACCGCGAACTTGTACAACGTTCGAGAATCGGGAGGGGCGAGAAATCGCTTTTTTCGATTCTCACCGCATCCAATTTGGCTTGCGAAAACAACTAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTTGAACTGATTGCCCGTGCCTCGTTGCCCCGTTCGCGGTGTGCTCGCGAGGTGCTGTGGCGTCTAAACGGACCAAAA

Click for details-----ITS2

ATCGCGTCGCCACGGCCGCCATATTCTTGTCGACGGGTGACGGAAATTGGCCTCCCGTGCCGCAAGGTGCGGTTGGCCTAAATGCGATTCCTTAGCTGGGGATGTCACGACAAGTGGTGGTTGAATTACTCAACTCGCGTGTTGTCGCGCCAGTACCCTTAGCGAGATTATTTTGACCCTCGAGCCTGAGTTATCTCAGGCCCTCGA
Taxonomic Information

Plant ID: NPO14335
Plant Latin Name: Ophiorrhiza Kuroiwae
Taxonomy Genus: Ophiorrhiza
Taxonomy Family: Rubiaceae

Plant External Links:

NCBI TaxonomyDB: 367364
Plant-of-the-World-Online: 50884217-1

Used in Medicines

Unknown.

Geographical Distribution

Philippines; Taiwan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

16 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


12 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

11 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC81970

Ingredient ID: NPC39102

Ingredient ID: NPC34103

Ingredient ID: NPC33611

Ingredient ID: NPC310340

Ingredient ID: NPC29883

Ingredient ID: NPC253481

Ingredient ID: NPC243728

Ingredient ID: NPC231149

Ingredient ID: NPC20603

Ingredient ID: NPC188783

Ingredient ID: NPC185326

Ingredient ID: NPC13422

Ingredient ID: NPC120464

Ingredient ID: NPC110958

Ingredient ID: NPC110396