• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Physalis Alkekengi


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CTGCGGAAGGATCATTGTCGAAACCTGCGAAGCAGAACGACCCGCGAACTCGTCCGAAAAACACCGGGGAGCCGGGCGGTCTGGGCGCTCCCGCCCCCCCTCCGCTCGTCTCCCTCGCATCCCCGGCGCGCGCGCGCGCCGCGCGCCCCGGGCGATGAACGAACCCCGGCGCGGAAAGCGCCAAGGAATACCGAACCGGCGGCCTGCCCCGCCGCGCCCCGTGCGCGGGGGGGACCTGTGCTTCGCTCGAAACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCTCACCCCGCGGGGTGTGGCGGGGCGGATACTGGCCTCCCGTGCGCCCGGAGCTCGCGGCCGGCCTAAATGCGAGCCCACGTCGACGGACGTCACGGCAGGTGGTGGTTGTAACTCAGCTCTCGAAGTGCCGTGGCCAGAGCCCGTCGCGCGTGTCGGCTGCGAGACCCTTCCAGCGCTCCGGCGCTCCGACCGCGACCCCAGGTCAGGCGGGACT

Click for details-----ITS1

CTGCGGAAGGATCATTGTCGAAACCTGCAGAGCAGAACGACCCGCGAACTCGTTCGAACACCGGGGAGCCGGGCGGTCGGGGCGCTCCCGCCCCCCCTCCGCTCGTCTCCCTCGCATCCCCGGCGCGCGCGCCCGCGCGCGCGCCGGGCGATTAACGAACCCCGGCGCGGAAAGCGCCAAGGAATACCGAACCGGCAGCCTGCCCCGCCGTGCCCCGCGCGCGGGGGGGACCTGCGCTCCGCCTGAAACACGAA

Click for details-----ITS2

ATCGCGTCGCCCCCCTCACCCCGCGGGGTGTGGCGGGGCGGATACTGGCCTCCCGCGCGCCCGGAGCTCGCGGCTGGCCCAAATGCGAGTCCACGTCGACGGACGTCACGGCAAGTGGTGGTTGTAACTCAACTCTCGGAGTGCCGTGGCCAGAGCCCGTCGCGCGTGTCGGCTGCGAGACCCTCCCAGCGCTTGGGCGCTCCGACCGCGACCCCAGGTCAGGCGGGATC
Taxonomic Information

Plant ID: NPO14304
Plant Latin Name: Physalis Alkekengi
Taxonomy Genus: Physalis
Taxonomy Family: Solanaceae

Plant External Links:

NCBI TaxonomyDB: 33120
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; South Korea; India

Traditional Medicine System:
Unani; TCM; Homeopathy; Ayurveda


Medicinal Functions:

Antiphlogistic; Antirheumatic; Antitussive; Aperient; Diuretic; Expectorant; Febrifuge; Homeopathy; Lithontripic

Geographical Distribution

India; South Korea; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

127 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


40 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

64 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97444

Ingredient ID: NPC95389

Ingredient ID: NPC95381

Ingredient ID: NPC93080

Ingredient ID: NPC91529

Ingredient ID: NPC89096

Ingredient ID: NPC85799

Ingredient ID: NPC85550

Ingredient ID: NPC81936

Ingredient ID: NPC81544

Ingredient ID: NPC76128

Ingredient ID: NPC70744

Ingredient ID: NPC69266

Ingredient ID: NPC67850

Ingredient ID: NPC65530

Ingredient ID: NPC6274

Ingredient ID: NPC60942

Ingredient ID: NPC60666

Ingredient ID: NPC58628

Ingredient ID: NPC53168

Ingredient ID: NPC50898

Ingredient ID: NPC5029

Ingredient ID: NPC48367

Ingredient ID: NPC47549

Ingredient ID: NPC46191

Ingredient ID: NPC3845

Ingredient ID: NPC3672

Ingredient ID: NPC3357

Ingredient ID: NPC33378

Ingredient ID: NPC312929

Ingredient ID: NPC30767

Ingredient ID: NPC305818

Ingredient ID: NPC304638

Ingredient ID: NPC30432

Ingredient ID: NPC303422

Ingredient ID: NPC29874

Ingredient ID: NPC293378

Ingredient ID: NPC290437

Ingredient ID: NPC289346

Ingredient ID: NPC288089

Ingredient ID: NPC282923

Ingredient ID: NPC279121

Ingredient ID: NPC277678

Ingredient ID: NPC276222

Ingredient ID: NPC274087

Ingredient ID: NPC273557

Ingredient ID: NPC272865

Ingredient ID: NPC272423

Ingredient ID: NPC271385

Ingredient ID: NPC264192

Ingredient ID: NPC263620

Ingredient ID: NPC26080

Ingredient ID: NPC260508

Ingredient ID: NPC257472

Ingredient ID: NPC254847

Ingredient ID: NPC254614

Ingredient ID: NPC254603

Ingredient ID: NPC254146

Ingredient ID: NPC252169

Ingredient ID: NPC251369

Ingredient ID: NPC250042

Ingredient ID: NPC248949

Ingredient ID: NPC248573

Ingredient ID: NPC247450

Ingredient ID: NPC245584

Ingredient ID: NPC243014

Ingredient ID: NPC242712

Ingredient ID: NPC242486

Ingredient ID: NPC235784

Ingredient ID: NPC233007

Ingredient ID: NPC228093

Ingredient ID: NPC22697

Ingredient ID: NPC226906

Ingredient ID: NPC225710

Ingredient ID: NPC22563

Ingredient ID: NPC223004

Ingredient ID: NPC221090

Ingredient ID: NPC219913

Ingredient ID: NPC219876

Ingredient ID: NPC217373

Ingredient ID: NPC21030

Ingredient ID: NPC206331

Ingredient ID: NPC205756

Ingredient ID: NPC204071

Ingredient ID: NPC203468

Ingredient ID: NPC200740

Ingredient ID: NPC196851

Ingredient ID: NPC194508

Ingredient ID: NPC192916

Ingredient ID: NPC19256

Ingredient ID: NPC191011

Ingredient ID: NPC190457

Ingredient ID: NPC190078

Ingredient ID: NPC189142

Ingredient ID: NPC188291

Ingredient ID: NPC181999

Ingredient ID: NPC179950

Ingredient ID: NPC178852

Ingredient ID: NPC178851

Ingredient ID: NPC176740

Ingredient ID: NPC173637

Ingredient ID: NPC168879

Ingredient ID: NPC165264

Ingredient ID: NPC164487

Ingredient ID: NPC161571

Ingredient ID: NPC160687

Ingredient ID: NPC158565

Ingredient ID: NPC157517

Ingredient ID: NPC156654

Ingredient ID: NPC15215

Ingredient ID: NPC150340

Ingredient ID: NPC142153

Ingredient ID: NPC139508

Ingredient ID: NPC137949

Ingredient ID: NPC13674

Ingredient ID: NPC124436

Ingredient ID: NPC118284

Ingredient ID: NPC117237

Ingredient ID: NPC116657

Ingredient ID: NPC113788

Ingredient ID: NPC111772

Ingredient ID: NPC109879

Ingredient ID: NPC108167

Ingredient ID: NPC106407

Ingredient ID: NPC102316

Ingredient ID: NPC100911

Ingredient ID: NPC100390