• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Uncaria Rhynchophylla


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCCGTAGTGAACCTGCGAAGGATCATTGTCGAATCCTGCGAAACGCACGACCGCGAACCTGTGTAAACAATCGGGCGTCGGGTGGTAGGGGAGACTAAGCCCTCCGTTCCCATCCGGCGCTACCCGCGCGCTCGTCGCGCGGAAAACGTAACTCAAACCCGGCGCGGAACGCGCCAAGGAAAACTCAATAGGACTGCCGGGCCCTCGATGCCCCGTACGCGGTGTGCTCGGGGTGCTGTGGCTCCTGTCGTAATCCAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCTAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCGCCCCCACCTATCGTGTGGGGCGGCGGATGTTGGCCTCCCGTGCCGTAAGGCGCGGCCGGCCTAAATGAGAGTCCTCGGCGAGGGACGTCACGACGAGTGGTGGTTGAATGCCCCGACTCGAGTTTTGTTGTGTCGGTTCCCATCGTCGTCTTCGGCTCCACGGATGACCCTAGTGCGCGTTCTGTTTGCAGTCGCGCCCCGA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCGCCGCCCCCACCTATCGTGTGGGGCGGCGGATGTTGGCCTCCCGTGCCGTAAGGCGCGGCCGGCCTAAATGAGAGTCCTCGGCGAGGGACGTCACGACGAGTGGTGGTTGAATGCCCCGACTCGAGTTTTGTTGTGTCGGTTCCCATCGTCGTCTTCGACTCCACGGATGACCCTAGTGCGCGTTCTGTTTGCAGTCGCGCCCCGAACGCGACCCAGGTC
Taxonomic Information

Plant ID: NPO14112
Plant Latin Name: Uncaria Rhynchophylla
Taxonomy Genus: Uncaria
Taxonomy Family: Rubiaceae

Plant External Links:

NCBI TaxonomyDB: 43575
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM; Kampo


Medicinal Functions:

Antidiarrhoeal; Antiemetic; Antispasmodic; Carminative; Febrifuge; Hepatic

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

175 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


92 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

107 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC97553

Ingredient ID: NPC97380

Ingredient ID: NPC94234

Ingredient ID: NPC92774

Ingredient ID: NPC85985

Ingredient ID: NPC85127

Ingredient ID: NPC84073

Ingredient ID: NPC82070

Ingredient ID: NPC80801

Ingredient ID: NPC7543

Ingredient ID: NPC74591

Ingredient ID: NPC731

Ingredient ID: NPC71853

Ingredient ID: NPC649

Ingredient ID: NPC63210

Ingredient ID: NPC61477

Ingredient ID: NPC59159

Ingredient ID: NPC57879

Ingredient ID: NPC54591

Ingredient ID: NPC54379

Ingredient ID: NPC51700

Ingredient ID: NPC49818

Ingredient ID: NPC486470

Ingredient ID: NPC486469

Ingredient ID: NPC486468

Ingredient ID: NPC486467

Ingredient ID: NPC486466

Ingredient ID: NPC486465

Ingredient ID: NPC486464

Ingredient ID: NPC486463

Ingredient ID: NPC486462

Ingredient ID: NPC486461

Ingredient ID: NPC486460

Ingredient ID: NPC486459

Ingredient ID: NPC486458

Ingredient ID: NPC486457

Ingredient ID: NPC486456

Ingredient ID: NPC486455

Ingredient ID: NPC486454

Ingredient ID: NPC486453

Ingredient ID: NPC486452

Ingredient ID: NPC486451

Ingredient ID: NPC486450

Ingredient ID: NPC486449

Ingredient ID: NPC486448

Ingredient ID: NPC486447

Ingredient ID: NPC486446

Ingredient ID: NPC486445

Ingredient ID: NPC486444

Ingredient ID: NPC486443

Ingredient ID: NPC486442

Ingredient ID: NPC486441

Ingredient ID: NPC486440

Ingredient ID: NPC486439

Ingredient ID: NPC486438

Ingredient ID: NPC486437

Ingredient ID: NPC486436

Ingredient ID: NPC47993

Ingredient ID: NPC476114

Ingredient ID: NPC475627

Ingredient ID: NPC475457

Ingredient ID: NPC475454

Ingredient ID: NPC475346

Ingredient ID: NPC475311

Ingredient ID: NPC47475

Ingredient ID: NPC473680

Ingredient ID: NPC473579

Ingredient ID: NPC468994

Ingredient ID: NPC40703

Ingredient ID: NPC40552

Ingredient ID: NPC36769

Ingredient ID: NPC3247

Ingredient ID: NPC324489

Ingredient ID: NPC322058

Ingredient ID: NPC319597

Ingredient ID: NPC312996

Ingredient ID: NPC312684

Ingredient ID: NPC310729

Ingredient ID: NPC309982

Ingredient ID: NPC308583

Ingredient ID: NPC306277

Ingredient ID: NPC305074

Ingredient ID: NPC302857

Ingredient ID: NPC302136

Ingredient ID: NPC299480

Ingredient ID: NPC298932

Ingredient ID: NPC29726

Ingredient ID: NPC294902

Ingredient ID: NPC293255

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC289227

Ingredient ID: NPC288590

Ingredient ID: NPC288537

Ingredient ID: NPC278068

Ingredient ID: NPC276993

Ingredient ID: NPC275463

Ingredient ID: NPC274330

Ingredient ID: NPC273374

Ingredient ID: NPC271686

Ingredient ID: NPC268160

Ingredient ID: NPC267691

Ingredient ID: NPC264711

Ingredient ID: NPC263709

Ingredient ID: NPC261619

Ingredient ID: NPC256923

Ingredient ID: NPC255696

Ingredient ID: NPC25529

Ingredient ID: NPC254240

Ingredient ID: NPC253627

Ingredient ID: NPC252635

Ingredient ID: NPC251619

Ingredient ID: NPC248056

Ingredient ID: NPC245312

Ingredient ID: NPC244753

Ingredient ID: NPC244572

Ingredient ID: NPC243728

Ingredient ID: NPC243673

Ingredient ID: NPC237532

Ingredient ID: NPC236202

Ingredient ID: NPC230301

Ingredient ID: NPC227138

Ingredient ID: NPC220765

Ingredient ID: NPC220151

Ingredient ID: NPC219876

Ingredient ID: NPC21752

Ingredient ID: NPC213711

Ingredient ID: NPC213066

Ingredient ID: NPC212143

Ingredient ID: NPC211755

Ingredient ID: NPC211525

Ingredient ID: NPC210415

Ingredient ID: NPC206728

Ingredient ID: NPC206232

Ingredient ID: NPC202407

Ingredient ID: NPC201287

Ingredient ID: NPC199851

Ingredient ID: NPC199607

Ingredient ID: NPC194130

Ingredient ID: NPC193410

Ingredient ID: NPC19019

Ingredient ID: NPC18982

Ingredient ID: NPC180804

Ingredient ID: NPC179787

Ingredient ID: NPC176740

Ingredient ID: NPC176006

Ingredient ID: NPC175612

Ingredient ID: NPC174788

Ingredient ID: NPC169318

Ingredient ID: NPC167976

Ingredient ID: NPC166456

Ingredient ID: NPC160125

Ingredient ID: NPC158956

Ingredient ID: NPC158733

Ingredient ID: NPC15658

Ingredient ID: NPC1556

Ingredient ID: NPC153694

Ingredient ID: NPC153585

Ingredient ID: NPC153095

Ingredient ID: NPC152489

Ingredient ID: NPC150310

Ingredient ID: NPC148468

Ingredient ID: NPC14515

Ingredient ID: NPC141782

Ingredient ID: NPC140008

Ingredient ID: NPC126029

Ingredient ID: NPC123625

Ingredient ID: NPC118958

Ingredient ID: NPC113989

Ingredient ID: NPC111602

Ingredient ID: NPC108811

Ingredient ID: NPC107782

Ingredient ID: NPC1075

Ingredient ID: NPC103585