• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Nardostachys Jatamansi


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCCGCAAGGCAGAACGACCCGCGAACACGTTTCCACACGGGGACCCCGGCCGAGAGGCCGGCGCTCCCACGGACGCGGGACCGTCAGGCCCCGCGGCCGCCAACCCAACCCCGGCGCGATCCGCGTCAAGGAAAAAGAAAACAGGAGGCGAGCGCGAGCCCGTGCGTCCCGTCCGCGGCGTCGGCCGGGCGAGCGCGACCCCCCTCGAACAAAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCGCCCGGCCTCCCGCGGAGGAGGCGCGCGGCGGGGGGCGCGGACAATGGCCTCCCGCGCCCCCGGGCACGGCTGGCCCAAAACCCAGTCCCCCGGCGGCGGACGTCACGACGAGTGGTGGTCGAAACAGCCCTCTTATCGCGTCGTGACCCGACCCGTCCGCCGGGCGGCCAAGGGACCC

Click for details-----ITS1

TCGAAACCCGCAAGGCAGAACGACCCGCGAACACGTTTCCACACGGGGACCCCGGCCGAGAGGCCGGCGCTCCCACGGACGCGGGACCGTCAGGCCCCGCGGCCGCCAACCCAACCCCGGCGCGATCCGCGTCAAGGAAAAAGAAAACAGGAGGCGAGCGCGAGCCCGTGCGTCCCGTCCGCGGCGTCGGCCGGGCGAGCGCGACCCCCCTCGAACAAAACACAAA

Click for details-----ITS2

ATTGTCTTGCCCACAAACCACTCACACTGAAAAGTTGAGCCGTGTTTGGGGGCGGAAACTGGCCTCCCGTACCTTGTCGTGCGGTTGGCGGAAAAACGAGTCTCCGGCGACGGACGTCTCGACATCGGGTGGTTGTAAAAGGCCCTCTTGTCTTGTCGTGCGAATCCTCTTCATCTTAGAGAGCTCCTGGACCCTTAGGCAGCACACACTCTGTGCGCTTCGACTGTGACCCCAGGTCAGGCGG
Taxonomic Information

Plant ID: NPO14108
Plant Latin Name: Nardostachys Jatamansi
Taxonomy Genus: Nardostachys
Taxonomy Family: Caprifoliaceae

Plant External Links:

NCBI TaxonomyDB: 179860
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Jordan; China; India; Thailand

Traditional Medicine System:
Sowa-Rigpa; TCM; Unani; Ayurveda; Siddha

Geographical Distribution

Bangladesh; Nepal; India; Jordan; Thailand; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

166 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


123 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

61 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99480

Ingredient ID: NPC96672

Ingredient ID: NPC95969

Ingredient ID: NPC93590

Ingredient ID: NPC88566

Ingredient ID: NPC87384

Ingredient ID: NPC8685

Ingredient ID: NPC84666

Ingredient ID: NPC81908

Ingredient ID: NPC81907

Ingredient ID: NPC81010

Ingredient ID: NPC78551

Ingredient ID: NPC76817

Ingredient ID: NPC72506

Ingredient ID: NPC71722

Ingredient ID: NPC71703

Ingredient ID: NPC70744

Ingredient ID: NPC70479

Ingredient ID: NPC66682

Ingredient ID: NPC66577

Ingredient ID: NPC60556

Ingredient ID: NPC52230

Ingredient ID: NPC51700

Ingredient ID: NPC50602

Ingredient ID: NPC46330

Ingredient ID: NPC40432

Ingredient ID: NPC39483

Ingredient ID: NPC39382

Ingredient ID: NPC39068

Ingredient ID: NPC38796

Ingredient ID: NPC38707

Ingredient ID: NPC38104

Ingredient ID: NPC37331

Ingredient ID: NPC36408

Ingredient ID: NPC32977

Ingredient ID: NPC3295

Ingredient ID: NPC329148

Ingredient ID: NPC328143

Ingredient ID: NPC321472

Ingredient ID: NPC320188

Ingredient ID: NPC319546

Ingredient ID: NPC314506

Ingredient ID: NPC311485

Ingredient ID: NPC307984

Ingredient ID: NPC30584

Ingredient ID: NPC304250

Ingredient ID: NPC302857

Ingredient ID: NPC301596

Ingredient ID: NPC30025

Ingredient ID: NPC299131

Ingredient ID: NPC298555

Ingredient ID: NPC297422

Ingredient ID: NPC295777

Ingredient ID: NPC29553

Ingredient ID: NPC295492

Ingredient ID: NPC294902

Ingredient ID: NPC292340

Ingredient ID: NPC290613

Ingredient ID: NPC290328

Ingredient ID: NPC29

Ingredient ID: NPC289143

Ingredient ID: NPC289120

Ingredient ID: NPC288537

Ingredient ID: NPC288528

Ingredient ID: NPC287711

Ingredient ID: NPC287331

Ingredient ID: NPC285371

Ingredient ID: NPC280281

Ingredient ID: NPC27397

Ingredient ID: NPC271362

Ingredient ID: NPC271118

Ingredient ID: NPC269145

Ingredient ID: NPC266706

Ingredient ID: NPC264711

Ingredient ID: NPC26219

Ingredient ID: NPC261815

Ingredient ID: NPC260756

Ingredient ID: NPC260265

Ingredient ID: NPC255662

Ingredient ID: NPC253619

Ingredient ID: NPC252635

Ingredient ID: NPC247818

Ingredient ID: NPC246903

Ingredient ID: NPC246543

Ingredient ID: NPC243809

Ingredient ID: NPC243776

Ingredient ID: NPC24327

Ingredient ID: NPC241407

Ingredient ID: NPC241067

Ingredient ID: NPC239037

Ingredient ID: NPC235468

Ingredient ID: NPC233397

Ingredient ID: NPC232548

Ingredient ID: NPC230332

Ingredient ID: NPC230301

Ingredient ID: NPC230291

Ingredient ID: NPC228346

Ingredient ID: NPC227731

Ingredient ID: NPC227730

Ingredient ID: NPC225106

Ingredient ID: NPC224543

Ingredient ID: NPC217191

Ingredient ID: NPC214522

Ingredient ID: NPC213749

Ingredient ID: NPC21180

Ingredient ID: NPC210293

Ingredient ID: NPC209567

Ingredient ID: NPC208361

Ingredient ID: NPC206050

Ingredient ID: NPC20588

Ingredient ID: NPC204610

Ingredient ID: NPC204145

Ingredient ID: NPC20306

Ingredient ID: NPC201342

Ingredient ID: NPC19900

Ingredient ID: NPC198381

Ingredient ID: NPC195745

Ingredient ID: NPC194297

Ingredient ID: NPC192638

Ingredient ID: NPC188380

Ingredient ID: NPC185538

Ingredient ID: NPC185352

Ingredient ID: NPC184831

Ingredient ID: NPC184049

Ingredient ID: NPC180418

Ingredient ID: NPC177281

Ingredient ID: NPC177112

Ingredient ID: NPC174826

Ingredient ID: NPC174368

Ingredient ID: NPC173991

Ingredient ID: NPC17216

Ingredient ID: NPC167976

Ingredient ID: NPC164706

Ingredient ID: NPC161557

Ingredient ID: NPC158411

Ingredient ID: NPC158079

Ingredient ID: NPC157192

Ingredient ID: NPC156705

Ingredient ID: NPC156654

Ingredient ID: NPC156353

Ingredient ID: NPC15622

Ingredient ID: NPC155172

Ingredient ID: NPC154361

Ingredient ID: NPC144698

Ingredient ID: NPC143639

Ingredient ID: NPC143095

Ingredient ID: NPC142897

Ingredient ID: NPC142415

Ingredient ID: NPC13991

Ingredient ID: NPC138811

Ingredient ID: NPC138347

Ingredient ID: NPC12870

Ingredient ID: NPC128690

Ingredient ID: NPC128457

Ingredient ID: NPC127122

Ingredient ID: NPC116467

Ingredient ID: NPC115207

Ingredient ID: NPC114239

Ingredient ID: NPC110899

Ingredient ID: NPC108211

Ingredient ID: NPC1075

Ingredient ID: NPC107473

Ingredient ID: NPC104796

Ingredient ID: NPC10455

Ingredient ID: NPC102511

Ingredient ID: NPC10187