• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Nardostachys Jatamansi


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCCGCAAGGCAGAACGACCCGCGAACACGTTTCCACACGGGGACCCCGGCCGAGAGGCCGGCGCTCCCACGGACGCGGGACCGTCAGGCCCCGCGGCCGCCAACCCAACCCCGGCGCGATCCGCGTCAAGGAAAAAGAAAACAGGAGGCGAGCGCGAGCCCGTGCGTCCCGTCCGCGGCGTCGGCCGGGCGAGCGCGACCCCCCTCGAACAAAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCGCCCGGCCTCCCGCGGAGGAGGCGCGCGGCGGGGGGCGCGGACAATGGCCTCCCGCGCCCCCGGGCACGGCTGGCCCAAAACCCAGTCCCCCGGCGGCGGACGTCACGACGAGTGGTGGTCGAAACAGCCCTCTTATCGCGTCGTGACCCGACCCGTCCGCCGGGCGGCCAAGGGACCC

Click for details-----ITS1

TCGAAACCCGCAAGGCAGAACGACCCGCGAACACGTTTCCACACGGGGACCCCGGCCGAGAGGCCGGCGCTCCCACGGACGCGGGACCGTCAGGCCCCGCGGCCGCCAACCCAACCCCGGCGCGATCCGCGTCAAGGAAAAAGAAAACAGGAGGCGAGCGCGAGCCCGTGCGTCCCGTCCGCGGCGTCGGCCGGGCGAGCGCGACCCCCCTCGAACAAAACACAAA

Click for details-----ITS2

ATTGTCTTGCCCACAAACCACTCACACTGAAAAGTTGAGCCGTGTTTGGGGGCGGAAACTGGCCTCCCGTACCTTGTCGTGCGGTTGGCGGAAAAACGAGTCTCCGGCGACGGACGTCTCGACATCGGGTGGTTGTAAAAGGCCCTCTTGTCTTGTCGTGCGAATCCTCTTCATCTTAGAGAGCTCCTGGACCCTTAGGCAGCACACACTCTGTGCGCTTCGACTGTGACCCCAGGTCAGGCGG
Taxonomic Information

Plant ID: NPO14108
Plant Latin Name: Nardostachys Jatamansi
Taxonomy Genus: Nardostachys
Taxonomy Family: Caprifoliaceae

Plant External Links:

NCBI TaxonomyDB: 179860
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Jordan; China; India; Thailand

Traditional Medicine System:
Sowa-Rigpa; TCM; Unani; Ayurveda; Siddha

Geographical Distribution

Bangladesh; Nepal; India; Jordan; Thailand; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

166 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


123 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

61 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC99480

Ingredient ID: NPC96672

Ingredient ID: NPC95969

Ingredient ID: NPC93590

Ingredient ID: NPC88566

Ingredient ID: NPC87384

Ingredient ID: NPC8685

Ingredient ID: NPC84666

Ingredient ID: NPC81908

Ingredient ID: NPC81907

Ingredient ID: NPC81010

Ingredient ID: NPC78551

Ingredient ID: NPC76817

Ingredient ID: NPC72506

Ingredient ID: NPC71722

Ingredient ID: NPC71703

Ingredient ID: NPC70744

Ingredient ID: NPC70479

Ingredient ID: NPC66682

Ingredient ID: NPC66577

Ingredient ID: NPC60556

Ingredient ID: NPC52230

Ingredient ID: NPC51700

Ingredient ID: NPC50602

Ingredient ID: NPC46330

Ingredient ID: NPC40432

Ingredient ID: NPC39483

Ingredient ID: NPC39382

Ingredient ID: NPC39068

Ingredient ID: NPC38796

Ingredient ID: NPC38707

Ingredient ID: NPC38104

Ingredient ID: NPC37331

Ingredient ID: NPC36408

Ingredient ID: NPC32977

Ingredient ID: NPC3295

Ingredient ID: NPC329148

Ingredient ID: NPC328143

Ingredient ID: NPC321472

Ingredient ID: NPC320188

Ingredient ID: NPC319546

Ingredient ID: NPC314506

Ingredient ID: NPC311485

Ingredient ID: NPC307984

Ingredient ID: NPC30584

Ingredient ID: NPC304250

Ingredient ID: NPC302857

Ingredient ID: NPC301596

Ingredient ID: NPC30025

Ingredient ID: NPC299131

Ingredient ID: NPC298555

Ingredient ID: NPC297422

Ingredient ID: NPC295777

Ingredient ID: NPC29553

Ingredient ID: NPC295492

Ingredient ID: NPC294902

Ingredient ID: NPC292340

Ingredient ID: NPC290613

Ingredient ID: NPC290328

Ingredient ID: NPC29

Ingredient ID: NPC289143

Ingredient ID: NPC289120

Ingredient ID: NPC288537

Ingredient ID: NPC288528

Ingredient ID: NPC287711

Ingredient ID: NPC287331

Ingredient ID: NPC285371

Ingredient ID: NPC280281

Ingredient ID: NPC27397

Ingredient ID: NPC271362

Ingredient ID: NPC271118

Ingredient ID: NPC269145

Ingredient ID: NPC266706

Ingredient ID: NPC264711

Ingredient ID: NPC26219

Ingredient ID: NPC261815

Ingredient ID: NPC260756

Ingredient ID: NPC260265

Ingredient ID: NPC255662

Ingredient ID: NPC253619

Ingredient ID: NPC252635

Ingredient ID: NPC247818

Ingredient ID: NPC246903

Ingredient ID: NPC246543

Ingredient ID: NPC243809

Ingredient ID: NPC243776

Ingredient ID: NPC24327

Ingredient ID: NPC241407

Ingredient ID: NPC241067

Ingredient ID: NPC239037

Ingredient ID: NPC235468

Ingredient ID: NPC233397

Ingredient ID: NPC232548

Ingredient ID: NPC230332

Ingredient ID: NPC230301

Ingredient ID: NPC230291

Ingredient ID: NPC228346

Ingredient ID: NPC227731

Ingredient ID: NPC227730

Ingredient ID: NPC225106

Ingredient ID: NPC224543

Ingredient ID: NPC217191

Ingredient ID: NPC214522

Ingredient ID: NPC213749

Ingredient ID: NPC21180

Ingredient ID: NPC210293

Ingredient ID: NPC209567

Ingredient ID: NPC208361

Ingredient ID: NPC206050

Ingredient ID: NPC20588

Ingredient ID: NPC204610

Ingredient ID: NPC204145

Ingredient ID: NPC20306

Ingredient ID: NPC201342

Ingredient ID: NPC19900

Ingredient ID: NPC198381

Ingredient ID: NPC195745

Ingredient ID: NPC194297

Ingredient ID: NPC192638

Ingredient ID: NPC188380

Ingredient ID: NPC185538

Ingredient ID: NPC185352

Ingredient ID: NPC184831

Ingredient ID: NPC184049

Ingredient ID: NPC180418

Ingredient ID: NPC177281

Ingredient ID: NPC177112

Ingredient ID: NPC174826

Ingredient ID: NPC174368

Ingredient ID: NPC173991

Ingredient ID: NPC17216

Ingredient ID: NPC167976

Ingredient ID: NPC164706

Ingredient ID: NPC161557

Ingredient ID: NPC158411

Ingredient ID: NPC158079

Ingredient ID: NPC157192

Ingredient ID: NPC156705

Ingredient ID: NPC156654

Ingredient ID: NPC156353

Ingredient ID: NPC15622

Ingredient ID: NPC155172

Ingredient ID: NPC154361

Ingredient ID: NPC144698

Ingredient ID: NPC143639

Ingredient ID: NPC143095

Ingredient ID: NPC142897

Ingredient ID: NPC142415

Ingredient ID: NPC13991

Ingredient ID: NPC138811

Ingredient ID: NPC138347

Ingredient ID: NPC12870

Ingredient ID: NPC128690

Ingredient ID: NPC128457

Ingredient ID: NPC127122

Ingredient ID: NPC116467

Ingredient ID: NPC115207

Ingredient ID: NPC114239

Ingredient ID: NPC110899

Ingredient ID: NPC108211

Ingredient ID: NPC1075

Ingredient ID: NPC107473

Ingredient ID: NPC104796

Ingredient ID: NPC10455

Ingredient ID: NPC102511

Ingredient ID: NPC10187

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Therapeutic Target Enzyme CES1 Acyl coenzyme A:cholesterol acyltransferase P23141 CHEMBL2265
Therapeutic Target Enzyme RECQL ATP-dependent DNA helicase Q1 P46063 CHEMBL1293236
Therapeutic Target Lyase CA2 Carbonic anhydrase II P00918 CHEMBL205
Therapeutic Target Lyase CA14 Carbonic anhydrase XIV Q9ULX7 CHEMBL3510
Therapeutic Target Metallo protease MMP1 Matrix metalloproteinase-1 P03956 CHEMBL332
Therapeutic Target Metallo protease MMP9 Matrix metalloproteinase 9 P14780 CHEMBL321
Therapeutic Target Metallo protease MMP2 Matrix metalloproteinase-2 P08253 CHEMBL333
Therapeutic Target Nuclear hormone receptor subfamily 1 NR1H4 Bile acid receptor FXR Q96RI1 CHEMBL2047
Therapeutic Target Nuclear hormone receptor subfamily 1 RORC Nuclear receptor ROR-gamma P51449 CHEMBL1741186
Therapeutic Target Oxidoreductase MAOA Monoamine oxidase A P21397 CHEMBL1951
Therapeutic Target Oxidoreductase HSD17B10 Endoplasmic reticulum-associated amyloid beta-peptide-binding protein Q99714 CHEMBL4159
Therapeutic Target Peptide receptor (family A GPCR) TSHR Thyroid stimulating hormone receptor P16473 CHEMBL1963
Therapeutic Target Protein Kinase MAPK1 MAP kinase ERK2 P28482 CHEMBL4040
Therapeutic Target Protein Phosphatase CDC25B Dual specificity phosphatase Cdc25B P30305 CHEMBL4804
Therapeutic Target Surface antigen F3 Coagulation factor III P13726 CHEMBL4081
Therapeutic Target Transcription factor RELA Nuclear factor NF-kappa-B p65 subunit Q04206 CHEMBL5533
Therapeutic Target Transcription factor NFKB1 Nuclear factor NF-kappa-B p105 subunit P19838 CHEMBL3251
Therapeutic Target Unclassified protein SNCA Alpha-synuclein P37840 CHEMBL6152
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level12
Plant level1
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT03758014 Studies of Chlorogenic Acid for Injection for Safety and Efficacy of Grade IV GBM Patients glioblastoma multiforme Chlorogenic Acid (NPC302857) NP level
NCT00483964 A Safety and Efficacy Study of Bacopa Monnieri and Nardostachys Jatamansi to Treat Schizophrenia Schizophrenia Nardostachys Jatamansi Plant level
As single plant
NCT02337933 Effect of Ursolic Acid Administration on Insulin Sensitivity and Metabolic Syndrome metabolic syndrome Ursolic Acid (NPC51700) NP level
NCT02728349 Tolerance and Pharmacokinetic Study of Chlorogenic Acid to Advanced Glioblastoma glioblastoma multiforme Chlorogenic Acid (NPC302857) NP level
NCT02136342 Phase 1 Trial of Chlorogenic Acid in Patients With Advanced Cancer cancer Chlorogenic Acid (NPC302857) NP level
NCT04648917 GASC1 Inhibitor Caffeic Acid for Squamous Esophageal Cell Cancer (ESCC) esophageal cancer Caffeic Acid (NPC294902) NP level
NCT02351622 Caffeic Acid Tablets as a Second-line Therapy for ITP autoimmune thrombocytopenic purpura Caffeic Acid (NPC294902) NP level
NCT04403568 Testing the Synergism of Phytonutrients, Curcumin and Ursolic Acid, to Target Molecular Pathways in the Prostate prostate cancer Ursolic Acid (NPC51700) NP level
NCT03216876 A Study Of Ursolic Acid For Primary Sclerosing Cholangitis sclerosing cholangitis Ursolic Acid (NPC51700) NP level
NCT02621060 Effect of Chlorogenic Acid on Patients With Impaired Glucose Tolerance abnormal glucose tolerance Chlorogenic Acid (NPC302857) NP level
NCT01119534 Comparative Efficacy of the Suppository Versus Guaiacol Suppository Versus Guaifenesin Syrup in Pediatric Patients With Cough Due the Infectious Origin Cough Eucalyptol (NPC287331) NP level
NCT03751592 Phase Ib/IIa Studies of Chlorogenic Acid for Injection for Safety and Efficacy of Advanced Lung Cancer lung cancer Chlorogenic Acid (NPC302857) NP level
NCT02245204 Phase I Studies of Chlorogenic Acid for Injection for Tolerance and Pharmacokinetic of Advanced Cancers cancer Chlorogenic Acid (NPC302857) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 MMP2,TSHR,HSD17B10,PTPN1,F3,TDP1,MMP1,AKR1B1,RECQL
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 CDC25B,SNCA,MMP2,MAPK1,CA14,F2,MMP1,AKR1B1,PTPRC
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 MAPK1,CA14,RELA,NFKB1,F3,MMP9,CA2,RORC
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 CA2,TSHR,TDP1,MMP9,AKR1B10,MMP1,RORC,PTPRC
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 CDC25B,MMP2,TSHR,PTPN1,MMP9,AKR1B10,MMP1,AKR1B1
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 CDC25B,SNCA,RECQL,MMP9,AKR1B10,MMP1,TDP1,PTPRC
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 AKR1B10,MMP9,TSHR,MMP9,F2,MMP1,PTPRC
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 AKR1B10,MMP1,MMP9,CDC25B,AKR1B10,MMP1,MMP9
Lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 CDC25B,RORC,MMP9,MMP1,MMP2
 NCT03751592
Rheumatoid arthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA20
 MMP1,MMP9,RELA,AKR1B1,CA2,NFKB1
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 SNCA,CA2,CA14,MMP9,MMP1,RORC
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 NFKB1,HSD17B10,MMP9,AKR1B10,AKR1B1,PTPRC
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 MMP2,F3,MMP9,MMP1,AKR1B1
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 MMP2,MMP9,AKR1B10,MMP1,AKR1B1
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 TSHR,MMP9,F2,AKR1B10,MMP1
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 TSHR,MMP9,F2,AKR1B10,MMP1
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 CA2,MMP9,F2,AKR1B10,MMP1
Multiple sclerosis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A40
 F2,RORC,NFKB1,RELA
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 F2,NFKB1,PTPN1,RELA
Crohn disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD70
 RORC,MMP9
 MMP1,MMP9
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 NFKB1,RELA,RORC
 AKR1B10
Pancreatic cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 MAPK1,F3,MMP1,MMP2
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 CDC25B,MMP9,F2,MMP1
Tetralogy of Fallot
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA88.2
 CA14,F2,RORC,F3
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 AKR1B1,MMP1,CA2,MMP9
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 KDM4E,CA2,CA14,MMP9
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 CA2,TSHR,AKR1B10,PTPRC
Brain cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00
 MMP2,MMP1,MMP9
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 PTPN1,CA14,CA2
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 PTPRC,NFKB1,RELA
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 MMP1,MMP9,F2
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 CDC25B,F2,MMP1
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 AKR1B10,MMP1,MMP9
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 CDC25B,MMP1,MMP9
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 SNCA,MMP1,MMP9
Schizophrenia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20
 AKR1B1
 NCT00483964
Atopic eczema
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA80
 RELA,NFKB1
Metabolic disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5D2Z
 PTPN1
 NCT02337933
Diabetes mellitus, type unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A14
 RELA,NFKB1
Choreiform disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A01
 RELA,NFKB1
Indeterminate colitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD72
 NFKB1,RELA
Bleeding disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA20-GA21
 F3,F2
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 SNCA,MAOA
Thrombosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB61-GB90
 F2,AKR1B1
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 PTPN1,AKR1B1
Acute/subacute hepatic failure
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB91
 RELA,NFKB1
Skin and skin-structure infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F28-1G0Z
 RELA,NFKB1
Renal cell carcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90
 MMP9,MMP2
Glaucoma
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C61
 CA2,AKR1B1
Ischaemic/haemorrhagic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B20
 MMP9,F2
Parkinsonism
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00
 MAOA,SNCA
Lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40
 NFKB1,RELA
Muscular dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C70
 NFKB1,RELA
Prostate cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82
 MAOA
 NCT04403568
Fungal infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F29-1F2F
 NFKB1,RELA
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 CA14,CA2
Irritable bowel syndrome
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD91
 NFKB1,RELA
Unspecified malignant neoplasms of unspecified sites
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D4Z
 NCT02136342,NCT02245204
Glioblastoma, primary, NOS
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH0MB1
 NCT03758014,NCT02728349
Inflammatory bowel diseases, unspecified
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD7Z
 MMP1,MMP9
Osteoarthritis, unspecified
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA0Z
 MMP2,MMP9
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 SNCA,CA2
Chronic rhinosinusitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA0A
 MMP1,MMP9
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 MMP9,F3
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 MMP2,F3
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 MMP9,MMP1
Gliomas of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.0
 AKR1B10,MMP9
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 CDC25B,SNCA,CES1,CA2,MMP2,PTPN1,CA14,RECQL,F2,AKR1B10,MMP1,PTPRC
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 CA2,TSHR,HSD17B10,TDP1,CA14,MMP9,AKR1B10,MMP1,AKR1B1,RORC
Substance abuse
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C40
 MAOA
Insomnia
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A00-7A0Z
 CA2
Malignant haematopoietic neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B33
 PTPRC
Nasopharyngeal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6B
 CDC25B
Hypo-thyroidism
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A00
 TSHR
Coagulation defect
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B10
 F2
Diffuse large B-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 PTPRC
Thyroid cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10
 TSHR
Transplant rejection
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE84
 PTPRC
Synthesis disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C52-5C59
 CES1
Coronary thrombosis
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA43
 F2
Acute respiratory distress syndrome
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB00
 F3
Mature T-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A90
 PTPRC
Thrombocytopenia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B64
 F2
Arteries/arterioles disorder
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD52
 MAPK1
Nutritional deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B50-5B71
 F2
Pain, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG3Z
 AKR1B1
Duodenal ulcer
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA63
 CA2
Hepatic fibrosis/cirrhosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB93
 MMP2
Ophthalmic devices/implants/grafts injury
Disease Category: 23.External causes of morbidity or mortality
Disease ICD-11 Code: PK97
 PTPN1
Hyper-lipoproteinaemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80
 CES1
Cardiovascular disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00-BE2Z
 F2
Angina pectoris
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA40
 F2
Myocardial infarction
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA41-BA43
 F2
Transplanted organ/tissue
Disease Category: 24.Factors influencing health status or contact with health services
Disease ICD-11 Code: QB63
 PTPRC
Acquired hypomelanotic disorder
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED63
 MAOA
Neuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C0Z
 AKR1B1
Peroxisomal disease
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C57
 CES1
Depression
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A70-6A7Z
 MAOA
Stomach cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 MMP9
Inborn metabolism deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5C59
 CA14
General pain disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E43
 MAOA
Seborrhoeic dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA81
 CA2
Low bone mass disorder
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB83
 CA2
Chronic arterial occlusive disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD4Z
 CES1
Cerebral ischaemic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B11
 F2
Autonomic nervous system disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8D87
 SNCA
Essential hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00
 CA2
Obesity
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B80-5B81
 PTPN1
Heart failure
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD10-BD1Z
 CA2
Autoimmune disease
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40-4A45
 RORC
Skin tag/polyp
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EK71
 MAOA
Cataract
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B10
 AKR1B1
Postoperative inflammation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-CA43
 PTPN1
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 F2
BCR-ABL1-negative chronic myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A41
 PTPRC
Mood disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A60-6E23
 MAOA
Melanoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 MAPK1
Ulcerative colitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD71
 MMP9
Acne vulgaris
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED80
 MMP2
Primary sclerosing cholangitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB96.2
 NCT03216876
Cough
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD12
 NCT01119534
Immune thrombocytopenic purpura
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B64.10
 NCT02351622
Esophageal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 NCT04648917
Impaired glucose tolerance
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A40.1
 NCT02621060
Coeliac disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA95
 TSHR
Myelodysplastic syndromes, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A3Z
 TSHR
Dengue fever, unspecified
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D2Z
 MAOA
Non-alcoholic fatty liver disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB92
 MMP9
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 NFKB1
Melanoma of skin
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 PTPRC
Pneumonia due to Pseudomonasaeruginosa
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA40.05
 MMP9
Systemic sclerosis
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A42
 MMP1
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 MMP1
Malaria, unspecified
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F4Z
 MMP9
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 CA2
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 MMP2
Lyme borreliosis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C1G
 MMP9

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group