• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Kadsura Interior


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

CCACTAGGCTGACCGGCGAACTTGTGATATTGTTCCTCGAGGGATGACGGTCTATCCTTGCGATACCGAAAACCCTTCCCCTCTCATTGCTCTACCTTGTTTGACACGCTTTGGTCTCGTGCCATGCGTTGATCCTTGGGTGCAGCACGAGGGAACGAACCAACAACATCGGCGCGGCATGCGTCAAGTAATAACAAACTGAAATAGGCTCTCCCCCCTGTTGTGTCCCCCTCAAGGGTACGGCTTGGGGGTGTTGCCACTTATTCTAATTGAAAACATAGA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO14102
Plant Latin Name: Kadsura Interior
Taxonomy Genus: Kadsura
Taxonomy Family: Schisandraceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

37 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


32 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

27 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC85141

Ingredient ID: NPC83049

Ingredient ID: NPC82753

Ingredient ID: NPC76415

Ingredient ID: NPC72833

Ingredient ID: NPC67397

Ingredient ID: NPC61543

Ingredient ID: NPC52005

Ingredient ID: NPC51700

Ingredient ID: NPC4940

Ingredient ID: NPC475953

Ingredient ID: NPC474948

Ingredient ID: NPC42230

Ingredient ID: NPC35637

Ingredient ID: NPC32189

Ingredient ID: NPC310247

Ingredient ID: NPC295293

Ingredient ID: NPC290714

Ingredient ID: NPC272471

Ingredient ID: NPC26803

Ingredient ID: NPC264317

Ingredient ID: NPC252281

Ingredient ID: NPC225585

Ingredient ID: NPC203891

Ingredient ID: NPC198461

Ingredient ID: NPC198129

Ingredient ID: NPC191352

Ingredient ID: NPC181049

Ingredient ID: NPC17941

Ingredient ID: NPC178383

Ingredient ID: NPC142415

Ingredient ID: NPC129796

Ingredient ID: NPC120464

Ingredient ID: NPC118162

Ingredient ID: NPC117154

Ingredient ID: NPC110167

Ingredient ID: NPC103448