• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Hypericum Ascyron


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTCCAAACGACCCGGGAACCGGTTATCCACACGTCGGGAGCGTCGGGCTGAACCCCGCAACCCCCGTGCGCGGGTGGCGGTCGGGCGTGCCAAGATCTTGGCACGGCCGGCCCGTCACCCGCCCAACAAACCAACCCCGGCGCGGCACGCGCCAAGGAACTTTGCATAACGAGTAGGACAACGCTCCCGGTCGTGCCGGAAATCGGACTACACGGCCGGTGGCTTTCCTTCTGTTCATAACCAAAACGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGTGTCACACAACGTCGCCCCCAAACCCAACGACTCGCTCGAGTTCGCTGGGCACCCGAGGGGCGGATAATGGTCTCCCGTGCGCTCCCATTCGCGGTTGGCCCAAAACTTTGTTCCCGGCGATCGCGAGCCACGACAAGCGGTGGTTGTAAGACCCTCGGTAATCATCGTGAGCCCGCGCGTCGGGACAATCGACCCCGAACGCGTTCCGGGGGAGACCCCGAACGCTCACAAA

Click for details-----ITS1

TGAAAGCCTCCAAACGACCCGGGAACCGGTTATCCACATGTCGGGGGCGTCGGGCTGAACCCCGCGAYCCCCGTGCGCGGGCGGCGGTCGGGCGTGCCAAGATCTTGGCACGGCCGGCCCGTCACCCGCCCAACAAACCAACCCCGGCGCGGCACGCGCCAAGGAACTTTGCATAACGAGGAGGACGACGCTCCCGGTCGTGCCGGAAATCGGACTACACGGCCGGTGGCTCTCCTTCTGTTCATAACCAAAA

Click for details-----ITS2

AACGTCGCCCCCAAACCCAACGACTCGCTCGAGTTCGCTGGGCACCCGAGGGGCGGATAATGGTCTCCCGTGCGCTCCCATTCGCGGTTGGCCCAAAACTTTGTTCCCGGCGATCGCGAGCCACGACAAGCGGTGGTTGTAAGACCCTCGGTAATCATCGTGAGCCCGCGCGTCGGGACAATCGACCCCGAACGCGTTCCGGGGGAGACCCCGAACGCTCACAAA
Taxonomic Information

Plant ID: NPO14089
Plant Latin Name: Hypericum Ascyron
Taxonomy Genus: Hypericum
Taxonomy Family: Hypericaceae

Plant External Links:

NCBI TaxonomyDB: 210378
Plant-of-the-World-Online: 30453546-2

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Depurative; Emmenagogue; Febrifuge; Poultice; Stings; VD; Vulnerary

Geographical Distribution

Canada; South Africa; Mongolia; United States; Vietnam; China; Japan; Taiwan; Kazakhstan; Russia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

154 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


34 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

57 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9860

Ingredient ID: NPC95610

Ingredient ID: NPC95062

Ingredient ID: NPC94659

Ingredient ID: NPC92117

Ingredient ID: NPC91955

Ingredient ID: NPC86655

Ingredient ID: NPC86136

Ingredient ID: NPC83291

Ingredient ID: NPC83189

Ingredient ID: NPC7447

Ingredient ID: NPC73483

Ingredient ID: NPC72468

Ingredient ID: NPC71195

Ingredient ID: NPC71180

Ingredient ID: NPC68324

Ingredient ID: NPC66718

Ingredient ID: NPC62223

Ingredient ID: NPC61341

Ingredient ID: NPC59593

Ingredient ID: NPC58877

Ingredient ID: NPC55098

Ingredient ID: NPC53757

Ingredient ID: NPC50315

Ingredient ID: NPC483005

Ingredient ID: NPC483004

Ingredient ID: NPC483003

Ingredient ID: NPC483002

Ingredient ID: NPC483001

Ingredient ID: NPC483000

Ingredient ID: NPC482999

Ingredient ID: NPC482998

Ingredient ID: NPC482997

Ingredient ID: NPC482996

Ingredient ID: NPC482995

Ingredient ID: NPC482994

Ingredient ID: NPC482993

Ingredient ID: NPC47933

Ingredient ID: NPC47826

Ingredient ID: NPC47521

Ingredient ID: NPC474770

Ingredient ID: NPC47234

Ingredient ID: NPC46274

Ingredient ID: NPC43918

Ingredient ID: NPC3474

Ingredient ID: NPC32109

Ingredient ID: NPC317111

Ingredient ID: NPC3146

Ingredient ID: NPC311389

Ingredient ID: NPC310581

Ingredient ID: NPC309701

Ingredient ID: NPC306397

Ingredient ID: NPC301077

Ingredient ID: NPC300911

Ingredient ID: NPC29549

Ingredient ID: NPC29506

Ingredient ID: NPC28514

Ingredient ID: NPC284934

Ingredient ID: NPC283506

Ingredient ID: NPC283174

Ingredient ID: NPC282818

Ingredient ID: NPC280008

Ingredient ID: NPC279943

Ingredient ID: NPC27871

Ingredient ID: NPC278127

Ingredient ID: NPC277686

Ingredient ID: NPC276202

Ingredient ID: NPC275463

Ingredient ID: NPC275048

Ingredient ID: NPC273789

Ingredient ID: NPC272844

Ingredient ID: NPC271482

Ingredient ID: NPC270797

Ingredient ID: NPC267627

Ingredient ID: NPC26703

Ingredient ID: NPC266580

Ingredient ID: NPC263583

Ingredient ID: NPC261623

Ingredient ID: NPC259866

Ingredient ID: NPC257546

Ingredient ID: NPC256766

Ingredient ID: NPC256392

Ingredient ID: NPC254168

Ingredient ID: NPC25389

Ingredient ID: NPC250436

Ingredient ID: NPC248995

Ingredient ID: NPC24627

Ingredient ID: NPC245827

Ingredient ID: NPC245240

Ingredient ID: NPC239943

Ingredient ID: NPC238400

Ingredient ID: NPC233210

Ingredient ID: NPC232622

Ingredient ID: NPC232364

Ingredient ID: NPC230818

Ingredient ID: NPC228715

Ingredient ID: NPC225710

Ingredient ID: NPC22451

Ingredient ID: NPC224281

Ingredient ID: NPC222930

Ingredient ID: NPC222183

Ingredient ID: NPC221870

Ingredient ID: NPC219876

Ingredient ID: NPC218736

Ingredient ID: NPC218109

Ingredient ID: NPC215875

Ingredient ID: NPC212031

Ingredient ID: NPC209434

Ingredient ID: NPC20791

Ingredient ID: NPC201814

Ingredient ID: NPC200119

Ingredient ID: NPC197396

Ingredient ID: NPC195380

Ingredient ID: NPC186628

Ingredient ID: NPC184318

Ingredient ID: NPC180474

Ingredient ID: NPC178134

Ingredient ID: NPC176740

Ingredient ID: NPC172419

Ingredient ID: NPC170034

Ingredient ID: NPC169749

Ingredient ID: NPC165382

Ingredient ID: NPC161571

Ingredient ID: NPC161066

Ingredient ID: NPC160512

Ingredient ID: NPC158306

Ingredient ID: NPC155525

Ingredient ID: NPC153031

Ingredient ID: NPC148358

Ingredient ID: NPC142393

Ingredient ID: NPC141361

Ingredient ID: NPC14030

Ingredient ID: NPC138883

Ingredient ID: NPC138118

Ingredient ID: NPC137698

Ingredient ID: NPC136859

Ingredient ID: NPC136464

Ingredient ID: NPC135222

Ingredient ID: NPC133821

Ingredient ID: NPC132250

Ingredient ID: NPC128792

Ingredient ID: NPC128484

Ingredient ID: NPC125062

Ingredient ID: NPC123316

Ingredient ID: NPC122818

Ingredient ID: NPC118502

Ingredient ID: NPC116850

Ingredient ID: NPC116775

Ingredient ID: NPC111490

Ingredient ID: NPC108776

Ingredient ID: NPC108455

Ingredient ID: NPC106574

Ingredient ID: NPC106071

Ingredient ID: NPC104222