• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Caulerpa Serrulata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

GCTAATTGTCGACCTTCATAGTCTCTCTTGCACTCTCATGTGAGTGTGCTAGACTCTCTATGAAGCAGTGGTTCAGTGAACAAGCATTCCACTCAATACGCGTGACTATGCTTGTGACGACTCCTTCTCACTATCGACTACTGATTGAGATCAACGACAGTATTTGTGACTTGCATACTCTATATGCTTGTCCTATAGCAATCAATCGCTGAGATTGAAGTGCCCGTTAACTGTGCTCGATAGTAATCTGGTTTTGACCACCACGTCTCTTTG
Taxonomic Information

Plant ID: NPO14043
Plant Latin Name: Caulerpa Serrulata
Taxonomy Genus: Caulerpa
Taxonomy Family: Caulerpaceae

Plant External Links:

NCBI TaxonomyDB: 177068
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

76 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


33 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

31 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96576

Ingredient ID: NPC93633

Ingredient ID: NPC90112

Ingredient ID: NPC8962

Ingredient ID: NPC87439

Ingredient ID: NPC84955

Ingredient ID: NPC84908

Ingredient ID: NPC77672

Ingredient ID: NPC76145

Ingredient ID: NPC75521

Ingredient ID: NPC64176

Ingredient ID: NPC60761

Ingredient ID: NPC54435

Ingredient ID: NPC41676

Ingredient ID: NPC37793

Ingredient ID: NPC3649

Ingredient ID: NPC34241

Ingredient ID: NPC33908

Ingredient ID: NPC32674

Ingredient ID: NPC307517

Ingredient ID: NPC300017

Ingredient ID: NPC299529

Ingredient ID: NPC293378

Ingredient ID: NPC284720

Ingredient ID: NPC281131

Ingredient ID: NPC280943

Ingredient ID: NPC277867

Ingredient ID: NPC268862

Ingredient ID: NPC264145

Ingredient ID: NPC259293

Ingredient ID: NPC251501

Ingredient ID: NPC251256

Ingredient ID: NPC247266

Ingredient ID: NPC243990

Ingredient ID: NPC240431

Ingredient ID: NPC237365

Ingredient ID: NPC225710

Ingredient ID: NPC22229

Ingredient ID: NPC216105

Ingredient ID: NPC2121

Ingredient ID: NPC20791

Ingredient ID: NPC198658

Ingredient ID: NPC195265

Ingredient ID: NPC194861

Ingredient ID: NPC190974

Ingredient ID: NPC188238

Ingredient ID: NPC184643

Ingredient ID: NPC179950

Ingredient ID: NPC178026

Ingredient ID: NPC176730

Ingredient ID: NPC169749

Ingredient ID: NPC168855

Ingredient ID: NPC168579

Ingredient ID: NPC161700

Ingredient ID: NPC161393

Ingredient ID: NPC160789

Ingredient ID: NPC149198

Ingredient ID: NPC14867

Ingredient ID: NPC147156

Ingredient ID: NPC142103

Ingredient ID: NPC140454

Ingredient ID: NPC137887

Ingredient ID: NPC136531

Ingredient ID: NPC133671

Ingredient ID: NPC131372

Ingredient ID: NPC125755

Ingredient ID: NPC123175

Ingredient ID: NPC119866

Ingredient ID: NPC116775

Ingredient ID: NPC115216

Ingredient ID: NPC114648

Ingredient ID: NPC114239

Ingredient ID: NPC11119

Ingredient ID: NPC109813

Ingredient ID: NPC107840

Ingredient ID: NPC106381