• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Uncaria Macrophylla


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCGAAACGCACGACCGCGAACCTGTGTGAACAACCGGGCGTCGGGTGGTAGGGGAGACTAAGCCCTCCATTCCCACCCGGCGCTCCCCGCGCGCTCGTCGCGCGGAAAACGTAACTCAAACCCGGCGCGGAACGCGCCAAGGAAAACTCAATAGGACTGTCGGGCCCCCGATGCCCCGTACGCGGTGTGCTCGGGGTGCCGCGGCGCCTGTCGTAATCCAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCGCCCCCACCCGTCGTGTGGGGCGGCGGATGTTGGCCTCCCGTGCCGTTAGGCGCGGCCGGCCTAAATGAGAGTCCTCGGCGAGGGACGTCACGACGAGTGGTGGTTGAATGCCCCGACTCGAGTTTTGTCGTGCCGGTTCCCATCGTCGTCTTCGGCTCCACGGATGACCCTAGTGCGCGATCTGTTTGCAGTCGCGCCCCGACCGCGACCCCAG

Click for details-----ITS1

TCGAATCCTGCGAAACGCACGACCGCGAACCTGTGTGAACAACCGGGCGTCGGGTGGTAGGGGAGACTAAGCCCTCCATTCCCACCCGGCGCTCCCCGCGCGCTCGTCGCGCGGAAAACGTAACTCAAACCCGGCGCGGAACGCGCCAAGGAAAACTCAATAGGACTGTCGGGCCCCCGATGCCCCGTACGCGGTGTGCTCGGGGTGCCGCGGCGCCTGTCGTAATCCAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO13989
Plant Latin Name: Uncaria Macrophylla
Taxonomy Genus: Uncaria
Taxonomy Family: Rubiaceae

Plant External Links:

NCBI TaxonomyDB: 714513
Plant-of-the-World-Online: 768275-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

Bangladesh; Myanmar; India; Cambodia; Vietnam; China; Laos; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

143 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


102 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

61 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC99886

Ingredient ID: NPC9794

Ingredient ID: NPC97380

Ingredient ID: NPC94563

Ingredient ID: NPC93956

Ingredient ID: NPC92774

Ingredient ID: NPC90522

Ingredient ID: NPC85127

Ingredient ID: NPC83732

Ingredient ID: NPC82070

Ingredient ID: NPC80801

Ingredient ID: NPC71853

Ingredient ID: NPC69216

Ingredient ID: NPC66577

Ingredient ID: NPC63210

Ingredient ID: NPC63199

Ingredient ID: NPC62469

Ingredient ID: NPC61477

Ingredient ID: NPC59159

Ingredient ID: NPC57879

Ingredient ID: NPC52059

Ingredient ID: NPC52001

Ingredient ID: NPC51700

Ingredient ID: NPC49818

Ingredient ID: NPC47993

Ingredient ID: NPC47475

Ingredient ID: NPC470069

Ingredient ID: NPC42852

Ingredient ID: NPC42672

Ingredient ID: NPC40552

Ingredient ID: NPC37644

Ingredient ID: NPC36769

Ingredient ID: NPC33605

Ingredient ID: NPC329148

Ingredient ID: NPC327897

Ingredient ID: NPC3247

Ingredient ID: NPC323581

Ingredient ID: NPC310403

Ingredient ID: NPC309982

Ingredient ID: NPC308583

Ingredient ID: NPC30430

Ingredient ID: NPC302857

Ingredient ID: NPC302136

Ingredient ID: NPC29726

Ingredient ID: NPC295777

Ingredient ID: NPC294902

Ingredient ID: NPC294820

Ingredient ID: NPC293255

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC288590

Ingredient ID: NPC288537

Ingredient ID: NPC28779

Ingredient ID: NPC287128

Ingredient ID: NPC278112

Ingredient ID: NPC278068

Ingredient ID: NPC276993

Ingredient ID: NPC273374

Ingredient ID: NPC272902

Ingredient ID: NPC271686

Ingredient ID: NPC271027

Ingredient ID: NPC26870

Ingredient ID: NPC267691

Ingredient ID: NPC266144

Ingredient ID: NPC265705

Ingredient ID: NPC264711

Ingredient ID: NPC263709

Ingredient ID: NPC26366

Ingredient ID: NPC26229

Ingredient ID: NPC261619

Ingredient ID: NPC257124

Ingredient ID: NPC25529

Ingredient ID: NPC254713

Ingredient ID: NPC251619

Ingredient ID: NPC248056

Ingredient ID: NPC245312

Ingredient ID: NPC244753

Ingredient ID: NPC243728

Ingredient ID: NPC243673

Ingredient ID: NPC242292

Ingredient ID: NPC242199

Ingredient ID: NPC239922

Ingredient ID: NPC239406

Ingredient ID: NPC238802

Ingredient ID: NPC237532

Ingredient ID: NPC236202

Ingredient ID: NPC233533

Ingredient ID: NPC231738

Ingredient ID: NPC230301

Ingredient ID: NPC229253

Ingredient ID: NPC223455

Ingredient ID: NPC22182

Ingredient ID: NPC22140

Ingredient ID: NPC219876

Ingredient ID: NPC217919

Ingredient ID: NPC21752

Ingredient ID: NPC211755

Ingredient ID: NPC211525

Ingredient ID: NPC210831

Ingredient ID: NPC210415

Ingredient ID: NPC207643

Ingredient ID: NPC202407

Ingredient ID: NPC198462

Ingredient ID: NPC196251

Ingredient ID: NPC195019

Ingredient ID: NPC194458

Ingredient ID: NPC194130

Ingredient ID: NPC186903

Ingredient ID: NPC176740

Ingredient ID: NPC176006

Ingredient ID: NPC174788

Ingredient ID: NPC167976

Ingredient ID: NPC162274

Ingredient ID: NPC161893

Ingredient ID: NPC161827

Ingredient ID: NPC16157

Ingredient ID: NPC15996

Ingredient ID: NPC158733

Ingredient ID: NPC157410

Ingredient ID: NPC15658

Ingredient ID: NPC1556

Ingredient ID: NPC153694

Ingredient ID: NPC153585

Ingredient ID: NPC148468

Ingredient ID: NPC141902

Ingredient ID: NPC14002

Ingredient ID: NPC139416

Ingredient ID: NPC138925

Ingredient ID: NPC133707

Ingredient ID: NPC12918

Ingredient ID: NPC126029

Ingredient ID: NPC123625

Ingredient ID: NPC123284

Ingredient ID: NPC120662

Ingredient ID: NPC116775

Ingredient ID: NPC113989

Ingredient ID: NPC111602

Ingredient ID: NPC108811

Ingredient ID: NPC107782

Ingredient ID: NPC1075

Ingredient ID: NPC102338

Ingredient ID: NPC100773

Ingredient ID: NPC10049

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Cytochrome P450 Cytochrome P450 family 1 CYP1B1 Cytochrome P450 1B1 Q16678 CHEMBL4878
Cytochrome P450 Cytochrome P450 family 1 CYP1A2 Cytochrome P450 1A2 P05177 CHEMBL3356
Cytochrome P450 Cytochrome P450 family 1 CYP1A1 Cytochrome P450 1A1 P04798 CHEMBL2231
Therapeutic Target Enzyme CES1 Acyl coenzyme A:cholesterol acyltransferase P23141 CHEMBL2265
Therapeutic Target Enzyme RECQL ATP-dependent DNA helicase Q1 P46063 CHEMBL1293236
Therapeutic Target Enzyme ALPL Alkaline phosphatase, tissue-nonspecific isozyme P05186 CHEMBL5979
Therapeutic Target Hydrolase ACHE Acetylcholinesterase P22303 CHEMBL220
Therapeutic Target Lyase CA12 Carbonic anhydrase XII O43570 CHEMBL3242
Therapeutic Target Lyase CA7 Carbonic anhydrase VII P43166 CHEMBL2326
Therapeutic Target Metallo protease MMP9 Matrix metalloproteinase 9 P14780 CHEMBL321
Therapeutic Target Metallo protease MMP1 Matrix metalloproteinase-1 P03956 CHEMBL332
Therapeutic Target Metallo protease MMP2 Matrix metalloproteinase-2 P08253 CHEMBL333
Therapeutic Target Nuclear hormone receptor subfamily 1 RORC Nuclear receptor ROR-gamma P51449 CHEMBL1741186
Therapeutic Target Nuclear hormone receptor subfamily 1 NR1H4 Bile acid receptor FXR Q96RI1 CHEMBL2047
Therapeutic Target Oxidoreductase HSD17B2 Estradiol 17-beta-dehydrogenase 2 P37059 CHEMBL2789
Therapeutic Target Oxidoreductase HSD17B10 Endoplasmic reticulum-associated amyloid beta-peptide-binding protein Q99714 CHEMBL4159
Therapeutic Target Peptide receptor (family A GPCR) TSHR Thyroid stimulating hormone receptor P16473 CHEMBL1963
Therapeutic Target Peptide receptor (family A GPCR) OPRM1 Mu opioid receptor P35372 CHEMBL233
Therapeutic Target Small molecule receptor (family A GPCR) ADRA1D Alpha-1d adrenergic receptor P25100 CHEMBL223
Therapeutic Target Surface antigen F3 Coagulation factor III P13726 CHEMBL4081
Therapeutic Target Transcription factor AHR Aryl hydrocarbon receptor P35869 CHEMBL3201
Therapeutic Target Transcription factor NFKB1 Nuclear factor NF-kappa-B p105 subunit P19838 CHEMBL3251
Therapeutic Target Transcription factor RELA Nuclear factor NF-kappa-B p65 subunit Q04206 CHEMBL5533
Therapeutic Target Transcription factor TP53 Cellular tumor antigen p53 P04637 CHEMBL4096
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level21
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT04386304 Safety and Biomarker Response to (+)-Epicatechin in Becker Muscular Dystrophy Becker muscular dystrophy (+)-Epicatechin (NPC261619) NP level
NCT01880866 (-)-Epicatechin and Pulmonary Arterial Hypertension pulmonary arterial hypertension (-)-Epicatechin (NPC126029) NP level
NCT02330276 Early Phase Pre-Clinical and Initial Clinical Research on Epicatechin prediabetes syndrome (+)-Epicatechin (NPC261619) NP level
NCT02337933 Effect of Ursolic Acid Administration on Insulin Sensitivity and Metabolic Syndrome metabolic syndrome Ursolic Acid (NPC51700) NP level
NCT04403568 Testing the Synergism of Phytonutrients, Curcumin and Ursolic Acid, to Target Molecular Pathways in the Prostate prostate cancer Ursolic Acid (NPC51700) NP level
NCT02136342 Phase 1 Trial of Chlorogenic Acid in Patients With Advanced Cancer cancer Chlorogenic Acid (NPC302857) NP level
NCT02660112 (+) Epicatechin to Treat Friedreich's Ataxia Friedreich ataxia (+)-Epicatechin (NPC261619) NP level
NCT04648917 GASC1 Inhibitor Caffeic Acid for Squamous Esophageal Cell Cancer (ESCC) esophageal cancer Caffeic Acid (NPC294902) NP level
NCT01856868 Use of (-)-Epicatechin in the Treatment of Becker Muscular Dystrophy (Pilot Study) Becker muscular dystrophy (-)-Epicatechin (NPC126029) NP level
NCT02964377 Plus Epicatechin Duchenne Muscular Dystrophy in Non-ambulatory Adolescents Duchenne muscular dystrophy (+)-Epicatechin (NPC261619) NP level
NCT03216876 A Study Of Ursolic Acid For Primary Sclerosing Cholangitis sclerosing cholangitis Ursolic Acid (NPC51700) NP level
NCT03758014 Studies of Chlorogenic Acid for Injection for Safety and Efficacy of Grade IV GBM Patients glioblastoma multiforme Chlorogenic Acid (NPC302857) NP level
NCT02728349 Tolerance and Pharmacokinetic Study of Chlorogenic Acid to Advanced Glioblastoma glioblastoma multiforme Chlorogenic Acid (NPC302857) NP level
NCT02621060 Effect of Chlorogenic Acid on Patients With Impaired Glucose Tolerance abnormal glucose tolerance Chlorogenic Acid (NPC302857) NP level
NCT01705652 Study to Assess the Activity of Nexrutine® in Prostate Cancer Patients prostate cancer Rutin (NPC176740) NP level
NCT01690676 Effect of an Apple Polyphenol Extract on Brachial Artery Flow-mediated Vasodilatory Function hypertension (+)-Epicatechin (NPC261619) NP level
NCT03236662 (-)- Epicatechin Becker Muscular Dystrophy Becker muscular dystrophy (-)-Epicatechin (NPC126029) NP level
NCT02351622 Caffeic Acid Tablets as a Second-line Therapy for ITP autoimmune thrombocytopenic purpura Caffeic Acid (NPC294902) NP level
NCT02245204 Phase I Studies of Chlorogenic Acid for Injection for Tolerance and Pharmacokinetic of Advanced Cancers cancer Chlorogenic Acid (NPC302857) NP level
NCT02656212 Early Phase Pre-Clinical and Initial Clinical Research on Epicatechin (Part 2) prediabetes syndrome (+)-Epicatechin (NPC261619) NP level
NCT03751592 Phase Ib/IIa Studies of Chlorogenic Acid for Injection for Safety and Efficacy of Advanced Lung Cancer lung cancer Chlorogenic Acid (NPC302857) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 CYP2C9,MMP9,TYR,ACHE,F2,TSHR,MMP9,MMP1
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 CA12,CYP2C9,F2,TSHR,MMP9,ACHE,MMP1,CA7
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 MMP2,F3,MMP9,TP53,MMP1,AKR1B1,CSNK2A3
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 DPP4,TSHR,MMP2,ALPL,MMP9,MMP1,AKR1B1
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 CA12,CYP2C9,F2,TSHR,MMP9,MMP1,CA7
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 CA12,ADRA1D,MMP9,MMP1,MMP9,CA12,MMP1
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 CYP2C9,F2,HSD17B2,MMP9,MMP1,ALPL,CYP1A1
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 DPP4,HSD17B2,MMP9,SNCA,MMP1,CA12,CA7
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 OPRM1,MMP9,ACHE,RORC,SNCA,MMP1
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 CA12,ADRA1D,MMP2,MMP9,MMP1,AKR1B1
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 CYP2C9,ADRA1D,MMP9,ACHE,KDM4E,CYP1A1
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CA12,DPP4,CYP1B1,MMP1,ALPL,CA7
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 RELA,DPP4,NFKB1,AHR,RORC
Lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 MMP9,MMP2,MMP1,RORC
 NCT03751592
Crohn disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD70
 MMP9,RORC
 ALPL,MMP9,MMP1
Rheumatoid arthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA20
 NFKB1,MMP9,AKR1B1,RELA,MMP1
Osteoarthritis, unspecified
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA0Z
 CA12,HSD17B2,MMP2,MMP9,ALPL
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 CYP2C9,MMP9,MMP1,CYP1A2,AKR1B1
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 DPP4,TSHR,CYP1B1,CA12,CSNK2A3
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 NFKB1,DPP4,F2,RELA
Multiple sclerosis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A40
 NFKB1,F2,RELA,RORC
Brain cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00
 MMP1,MMP9,TP53,MMP2
Pain, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG3Z
 OPRM1,ACHE,ADRA1D,AKR1B1
Pancreatic cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 TP53,MMP2,MMP1,F3
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 F2,TYR,MMP1,CYP1A1
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 F3,MMP9,ACHE,CYP1A1
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 NFKB1,RELA,TP53
Atopic eczema
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA80
 NFKB1,RELA,AHR
Pulmonary hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BB01
 ADRA1D
 NCT01690676,NCT01880866
Chronic arterial occlusive disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD4Z
 TP53,DPP4,CES1
Irritable bowel syndrome
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD91
 RELA,OPRM1,NFKB1
Diabetes mellitus, type unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A14
 DPP4,NFKB1,RELA
Glaucoma
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C61
 ACHE,AKR1B1,ADRA1D
Becker muscular dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C70.0
 NCT03236662,NCT04386304,NCT01856868
Inflammatory bowel diseases, unspecified
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD7Z
 ALPL,MMP9,MMP1
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 F2,MMP9,MMP1
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 F2,MMP9,MMP1
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 NFKB1,ACHE,DPP4
Tetralogy of Fallot
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA88.2
 F2,F3,RORC
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 CA12,MMP9,MMP1
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 ACHE,DPP4,SNCA
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 MMP9,ACHE,MMP1
Chronic rhinosinusitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA0A
 MMP9,CYP1A1,MMP1
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 CA12,MMP9,MMP1
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 CA12,CYP1A2,CYP1A1
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 DPP4,MMP2,CYP1B1
Skin and skin-structure infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F28-1G0Z
 NFKB1,RELA
Myocardial infarction
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA41-BA43
 DPP4,F2
Thrombocytopenia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B64
 F2,AHR
Lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40
 NFKB1,RELA
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 ACHE,SNCA
Malignant haematopoietic neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B33
 TP53,DPP4
Parkinsonism
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00
 SNCA,ACHE
Myelodysplastic syndrome
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A37
 TP53,AHR
Indeterminate colitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD72
 RELA,NFKB1
Neuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C0Z
 AKR1B1,OPRM1
Ischaemic/haemorrhagic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B20
 MMP9,F2
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 CA12,CYP2C9
Bleeding disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA20-GA21
 F3,F2
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 AKR1B1,DPP4
Renal cell carcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90
 MMP9,MMP2
Esophageal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 TP53
 NCT04648917
Choreiform disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A01
 NFKB1,RELA
Substance abuse
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C40
 OPRM1,ACHE
Fungal infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F29-1F2F
 NFKB1,RELA
Muscular dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C70
 NFKB1,RELA
Thrombosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB61-GB90
 AKR1B1,F2
Metabolic disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5D2Z
 DPP4
 NCT02337933
Acute/subacute hepatic failure
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB91
 RELA,NFKB1
Stomach cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 MMP9,TP53
Intermediate hyperglycaemia, unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A40.Z
 NCT02330276,NCT02656212
Glioblastoma, primary, NOS
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH0MB1
 NCT02728349,NCT03758014
Unspecified malignant neoplasms of unspecified sites
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D4Z
 NCT02245204,NCT02136342
Prostate cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82
 NCT04403568,NCT01705652
Coeliac disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA95
 CYP1A1,TSHR
Myelodysplastic syndromes, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A3Z
 CYP2C9,TSHR
Pneumonia due to Pseudomonasaeruginosa
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA40.05
 MMP9,DPP4
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 MMP2,F3
Ebola virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D60.01
 ACHE,HSD17B2
Gliomas of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.0
 MMP9,AHR
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 CISD1,RECQL,MMP1,MMP2,TDP1,TSHR,CSNK2A2,TP53,F3,ACHE,AHR,CA12,AKR1B1,HSD17B10
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 TDP1,DPP4,HSD17B2,TSHR,AKR1B1,CISD1,MMP9,RORC,TP53,MMP1,ALPL,CA7,HSD17B10
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 CA12,TDP1,HSD17B2,TSHR,ALPL,CISD1,MMP9,RORC,AHR,MMP1,CYP1A2,TP53,CSNK2A3
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 CYP2C9,F2,DPP4,HSD17B2,MMP2,CES1,CISD1,RECQL,CYP1B1,ACHE,SNCA,MMP1,CA7
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 TDP1,DPP4,HSD17B2,CSNK2A2,MMP9,RECQL,TYR,AHR,SNCA,MMP1,CA12,CA7
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 CYP2C9,F2,DPP4,HSD17B2,MMP2,ACHE,AHR,SNCA,MMP1,CA12,AKR1B1
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 TP53,RELA,CSNK2A1,CA12,F3,MMP9,ADRA1D,RORC,NFKB1,AHR
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 CYP2C9,DPP4,HSD17B2,NFKB1,CISD1,MMP9,ACHE,CYP1B1,AKR1B1,HSD17B10
Coronary vasospastic disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA85
 OPRM1
Acute respiratory distress syndrome
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB00
 F3
Myasthenia gravis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C6Y
 ACHE
Genetic prion disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E02
 ALPL
Obesity
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B80-5B81
 OPRM1
Acquired hypomelanotic disorder
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED63
 TYR
Peroxisomal disease
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C57
 CES1
Migraine
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A80
 OPRM1
Cervical cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C77
 TP53
Skin sensation disturbance
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: ME65
 OPRM1
Thyroid cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10
 TSHR
Sexual dysfunction
Disease Category: 17.Conditions related to sexual health
Disease ICD-11 Code: HA00-HA01
 ADRA1D
Fallopian tube cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C74
 TP53
Lip/oral cavity/pharynx neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6E
 TP53
Peritoneal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C51
 TP53
Mild neurocognitive disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D71
 ACHE
Acquired hypermelanosis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED60
 TYR
Ovarian dysfunction
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80
 TP53
Angina pectoris
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA40
 F2
Breathing abnormality
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD11
 OPRM1
Bowel habit change
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: ME05
 OPRM1
Colorectal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B91
 TP53
Liver cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12
 CSNK2A1
Mature B-cell leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A82
 TP53
Hepatic fibrosis/cirrhosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB93
 MMP2
Dementia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D80-6D8Z
 ACHE
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 F2
Multiple myeloma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A83
 AHR
Coagulation defect
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B10
 F2
Kidney failure
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB60-GB6Z
 TP53
Heart failure
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD10-BD1Z
 ADRA1D
Depression
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A70-6A7Z
 OPRM1
Coronary thrombosis
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA43
 F2
Bladder cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94
 TP53
Cough
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD12
 OPRM1
Pruritus
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EC90
 OPRM1
Large intestine motility disorder
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB32
 OPRM1
Cerebral ischaemic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B11
 F2
Metastatic liver/bile duct neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D80
 TP53
Acne vulgaris
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED80
 MMP2
Cataract
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B10
 AKR1B1
Coronavirus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D92
 CSNK2A1
Synthesis disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C52-5C59
 CES1
Opioid use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C43
 OPRM1
Hyper-lipoproteinaemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80
 CES1
Parasitic infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D0Y-1G2Z
 ALPL
Ovarian cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73
 TP53
Hypo-thyroidism
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A00
 TSHR
Ulcerative colitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD71
 MMP9
Colon cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90
 ALPL
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 CA12
Prostate hyperplasia
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA90
 ADRA1D
Seborrhoeic dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA81
 CA12
Head and neck cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D42
 TP53
Parasitic worm infestation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F90
 ACHE
Autism spectrum disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A02
 DPP4
Nutritional deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B50-5B71
 F2
Binge eating disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6B82
 OPRM1
Mental/behavioural/neurodevelopmental disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6E20-6E8Z
 OPRM1
Chronic pain
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG30
 OPRM1
Liposarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B59
 TP53
Autoimmune disease
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40-4A45
 RORC
Autonomic nervous system disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8D87
 SNCA
Oesophageal/gastroduodenal disorder
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD90
 ACHE
Schizophrenia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20
 AKR1B1
Ureteral cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C92
 AHR
Melanoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 TYR
Digestive system disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DE2Z
 OPRM1
Cardiovascular disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00-BE2Z
 F2
Spinal pain
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: ME84
 OPRM1
General pain disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E43
 OPRM1
Tension-type headache
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A81
 OPRM1
Unspecific substance harmful effect
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE6Z
 ACHE
Transplant rejection
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE84
 TP53
Pediculosis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1G00
 ACHE
Corneal disease
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9A76-9A78
 OPRM1
Acute pain
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG31
 OPRM1
Endometrial cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76
 TP53
Primary sclerosing cholangitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB96.2
 NCT03216876
Friedreich ataxia
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A03.10
 NCT02660112
Impaired glucose tolerance
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A40.1
 NCT02621060
Duchenne muscular dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C70.1
 NCT02964377
Immune thrombocytopenic purpura
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B64.10
 NCT02351622
Zika virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D48
 ACHE
Atrial fibrillation
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC81.3
 CA7
Non-alcoholic fatty liver disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB92
 MMP9
Myotonic dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71.0
 CYP1A1
Systemic sclerosis
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A42
 MMP1
Heart failure, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD1Z
 CYP1B1
Malaria, unspecified
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F4Z
 MMP9
Lyme borreliosis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C1G
 MMP9

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group