• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Uncaria Macrophylla


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCGAAACGCACGACCGCGAACCTGTGTGAACAACCGGGCGTCGGGTGGTAGGGGAGACTAAGCCCTCCATTCCCACCCGGCGCTCCCCGCGCGCTCGTCGCGCGGAAAACGTAACTCAAACCCGGCGCGGAACGCGCCAAGGAAAACTCAATAGGACTGTCGGGCCCCCGATGCCCCGTACGCGGTGTGCTCGGGGTGCCGCGGCGCCTGTCGTAATCCAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCGCCCCCACCCGTCGTGTGGGGCGGCGGATGTTGGCCTCCCGTGCCGTTAGGCGCGGCCGGCCTAAATGAGAGTCCTCGGCGAGGGACGTCACGACGAGTGGTGGTTGAATGCCCCGACTCGAGTTTTGTCGTGCCGGTTCCCATCGTCGTCTTCGGCTCCACGGATGACCCTAGTGCGCGATCTGTTTGCAGTCGCGCCCCGACCGCGACCCCAG

Click for details-----ITS1

TCGAATCCTGCGAAACGCACGACCGCGAACCTGTGTGAACAACCGGGCGTCGGGTGGTAGGGGAGACTAAGCCCTCCATTCCCACCCGGCGCTCCCCGCGCGCTCGTCGCGCGGAAAACGTAACTCAAACCCGGCGCGGAACGCGCCAAGGAAAACTCAATAGGACTGTCGGGCCCCCGATGCCCCGTACGCGGTGTGCTCGGGGTGCCGCGGCGCCTGTCGTAATCCAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO13989
Plant Latin Name: Uncaria Macrophylla
Taxonomy Genus: Uncaria
Taxonomy Family: Rubiaceae

Plant External Links:

NCBI TaxonomyDB: 714513
Plant-of-the-World-Online: 768275-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

Bangladesh; Myanmar; India; Cambodia; Vietnam; China; Laos; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

143 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


102 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

61 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC9794

Ingredient ID: NPC97380

Ingredient ID: NPC94563

Ingredient ID: NPC93956

Ingredient ID: NPC92774

Ingredient ID: NPC90522

Ingredient ID: NPC85127

Ingredient ID: NPC83732

Ingredient ID: NPC82070

Ingredient ID: NPC80801

Ingredient ID: NPC71853

Ingredient ID: NPC69216

Ingredient ID: NPC66577

Ingredient ID: NPC63210

Ingredient ID: NPC63199

Ingredient ID: NPC62469

Ingredient ID: NPC61477

Ingredient ID: NPC59159

Ingredient ID: NPC57879

Ingredient ID: NPC52059

Ingredient ID: NPC52001

Ingredient ID: NPC51700

Ingredient ID: NPC49818

Ingredient ID: NPC47993

Ingredient ID: NPC47475

Ingredient ID: NPC470069

Ingredient ID: NPC42852

Ingredient ID: NPC42672

Ingredient ID: NPC40552

Ingredient ID: NPC37644

Ingredient ID: NPC36769

Ingredient ID: NPC33605

Ingredient ID: NPC329148

Ingredient ID: NPC327897

Ingredient ID: NPC3247

Ingredient ID: NPC323581

Ingredient ID: NPC310403

Ingredient ID: NPC309982

Ingredient ID: NPC308583

Ingredient ID: NPC30430

Ingredient ID: NPC302857

Ingredient ID: NPC302136

Ingredient ID: NPC29726

Ingredient ID: NPC295777

Ingredient ID: NPC294902

Ingredient ID: NPC294820

Ingredient ID: NPC293255

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC288590

Ingredient ID: NPC288537

Ingredient ID: NPC28779

Ingredient ID: NPC287128

Ingredient ID: NPC278112

Ingredient ID: NPC278068

Ingredient ID: NPC276993

Ingredient ID: NPC273374

Ingredient ID: NPC272902

Ingredient ID: NPC271686

Ingredient ID: NPC271027

Ingredient ID: NPC26870

Ingredient ID: NPC267691

Ingredient ID: NPC266144

Ingredient ID: NPC265705

Ingredient ID: NPC264711

Ingredient ID: NPC263709

Ingredient ID: NPC26366

Ingredient ID: NPC26229

Ingredient ID: NPC261619

Ingredient ID: NPC257124

Ingredient ID: NPC25529

Ingredient ID: NPC254713

Ingredient ID: NPC251619

Ingredient ID: NPC248056

Ingredient ID: NPC245312

Ingredient ID: NPC244753

Ingredient ID: NPC243728

Ingredient ID: NPC243673

Ingredient ID: NPC242292

Ingredient ID: NPC242199

Ingredient ID: NPC239922

Ingredient ID: NPC239406

Ingredient ID: NPC238802

Ingredient ID: NPC237532

Ingredient ID: NPC236202

Ingredient ID: NPC233533

Ingredient ID: NPC231738

Ingredient ID: NPC230301

Ingredient ID: NPC229253

Ingredient ID: NPC223455

Ingredient ID: NPC22182

Ingredient ID: NPC22140

Ingredient ID: NPC219876

Ingredient ID: NPC217919

Ingredient ID: NPC21752

Ingredient ID: NPC211755

Ingredient ID: NPC211525

Ingredient ID: NPC210831

Ingredient ID: NPC210415

Ingredient ID: NPC207643

Ingredient ID: NPC202407

Ingredient ID: NPC198462

Ingredient ID: NPC196251

Ingredient ID: NPC195019

Ingredient ID: NPC194458

Ingredient ID: NPC194130

Ingredient ID: NPC186903

Ingredient ID: NPC176740

Ingredient ID: NPC176006

Ingredient ID: NPC174788

Ingredient ID: NPC167976

Ingredient ID: NPC162274

Ingredient ID: NPC161893

Ingredient ID: NPC161827

Ingredient ID: NPC16157

Ingredient ID: NPC15996

Ingredient ID: NPC158733

Ingredient ID: NPC157410

Ingredient ID: NPC15658

Ingredient ID: NPC1556

Ingredient ID: NPC153694

Ingredient ID: NPC153585

Ingredient ID: NPC148468

Ingredient ID: NPC141902

Ingredient ID: NPC14002

Ingredient ID: NPC139416

Ingredient ID: NPC138925

Ingredient ID: NPC133707

Ingredient ID: NPC12918

Ingredient ID: NPC126029

Ingredient ID: NPC123625

Ingredient ID: NPC123284

Ingredient ID: NPC120662

Ingredient ID: NPC116775

Ingredient ID: NPC113989

Ingredient ID: NPC111602

Ingredient ID: NPC108811

Ingredient ID: NPC107782

Ingredient ID: NPC1075

Ingredient ID: NPC102338

Ingredient ID: NPC100773

Ingredient ID: NPC10049