• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Zanthoxylum Rubescens


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CCGATGCCTCTGCGAGAGCAGAATGACCCGCGAACTTGTGATGACACCCACAGGAGGGAGCGCCATCCGGCCATCCCCCCCAAGCTTCCGCGGGTGCGGGGACACTCCCGTTCCCCGCGGGGGCGCAACAAACCCCCGGCGCGGACCGCGCCAAGGAAATACAACGGGATAGTGCGAGCGTTCCCGGGGCCCCGAACACGGTGCGCTCCGAGGCGCCGTGCCTTATTTCGAATTTAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATTATTGCCCCACCCCACCCCCTCCCCGGGGGCACGGCGGTGCGGGCGGACAATGGCCTCCCGTGCACTCCGCGGTTGGCCCAAATTCGAGTCCCCGGTGACCGGTGCCGCGACGATCGGTGGTGAGAAAAACCCTCTCGAGCTCGCATCGCGCACCCGTCCATCCGAGTCGGGACTCATCGACCCTGTAGCTCCGGGCCAGCGGTGCTCGTA

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO1391
Plant Latin Name: Zanthoxylum Rubescens
Taxonomy Genus: Zanthoxylum
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

10 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


0 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

2 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC54394

Ingredient ID: NPC48364

Ingredient ID: NPC30315

Ingredient ID: NPC247519

Ingredient ID: NPC238618

Ingredient ID: NPC238123

Ingredient ID: NPC190067

Ingredient ID: NPC183799

Ingredient ID: NPC177309

Ingredient ID: NPC120099