• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Gnaphalium Oligandrum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGTGTCGCCCCCTACCACTCCTCAAATGGATGCTTGGTGTGGGGGCGGATATTGGTCTCCTGTATCTCTGATACGGTTGGCCAAAATACGAGTCCCTGTCGATGGACGCACGACTAGTGGTGGTTGCTAAAACCTTCGTCTTTGGTTGTGCATCTTCATTCGTGCGGGAAGCTTAAAGACCCCAATGTGTT
Taxonomic Information

Plant ID: NPO13868
Plant Latin Name: Gnaphalium Oligandrum
Taxonomy Genus: Gnaphalium
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

26 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


24 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

22 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC90615

Ingredient ID: NPC82217

Ingredient ID: NPC8127

Ingredient ID: NPC73535

Ingredient ID: NPC73505

Ingredient ID: NPC65885

Ingredient ID: NPC51700

Ingredient ID: NPC49667

Ingredient ID: NPC34431

Ingredient ID: NPC272157

Ingredient ID: NPC25111

Ingredient ID: NPC230301

Ingredient ID: NPC225710

Ingredient ID: NPC216842

Ingredient ID: NPC201145

Ingredient ID: NPC192638

Ingredient ID: NPC190729

Ingredient ID: NPC189023

Ingredient ID: NPC18785

Ingredient ID: NPC183211

Ingredient ID: NPC179950

Ingredient ID: NPC171137

Ingredient ID: NPC165967

Ingredient ID: NPC165026

Ingredient ID: NPC117437

Ingredient ID: NPC109071