• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Mentha Canadensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAAACTGCAAAGCAGATCGTGAACACGTAACTAACGCCACGGAGCACAATGCAGGGGCGACCGTTTGCCATGTCCCGTGTCCTGCCAGCATGTTCCCTCGGGTYATGCCATGCGGGCTAACGAACCCCGGCACAGAATGCATCAAGGAAAACAAAATGAAGCATCYGCCTCGGGCATYGTGTTYGCAGAGAGTTCCATGGGATCGAGAGTCTATCAAATGTTAAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCATGTCACACCCTACCCCACGTGAATCGCCGGGCGGTTGGGGGTGGATACTGGCCTCCCGTGTGCCTCGGCAAGTGGCCGGCCTAAATGGGATCCCTAGACGACTGGCGTCACGACAAGTGGTGGTTGAACATCTTAATCTCCTCATGGTCATGTTGTCATATCGTCCCATACAAGAATCATAAATGACCCAAYGGTGCATGGCGCAAATAGCGTCTCACTTTTGACTGTGACCCCAGTCAGCGGGATTGCCCATTTAGTTTAAGCATATCAT

Click for details-----ITS1

GCGGAGATCATTGTCGAACCTCGCAAAGCAGACTGCGAACACGTAATTAACTCCGCGGGCCACGGCAAGGGGGCGACCCCTTGCCGTGTCCTGTCCCCCGCCGGCGTGTTCCCTCGGGTCACGTCGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACCAAACGAAGCGTCCGCCCCCGGCACCCCGTTCGCGGAGCGTGCCGTGGGACCGGCCGTCTATCAAATGTCAAAA

Click for details-----ITS2

ATCATGTCACACCCTACCCCACGTGAATCGCCGGGCGGTTGGGGGTGGATACTGGCCTCCCGTGTGCCTCGGCAAGTGGCCGGCCTAAATGGGATCCCTAGACGACTGGCGTCACGACAAGTGGTGGTTGAACATCTTAATCTCCTCATGGTCATGTTGTCATATCGTCCCATACAAGAATCATAAATGACCCAAYGGTGCATGGCGCAAATAGCGTCTCACTTTTGACTGTGACCCCAGTCAGCGGGATTGCCCATTTAGTTTAAGCATATCAT
Taxonomic Information

Plant ID: NPO13857
Plant Latin Name: Mentha Canadensis
Taxonomy Genus: Mentha
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 294733
Plant-of-the-World-Online: 450311-1

Used in Medicines

Country/Region:
Russia

Traditional Medicine System:

Geographical Distribution

Canada; Georgia; Myanmar; Mexico; Thailand; Philippines; Indonesia; Cambodia; South Africa; United States; Vietnam; China; Mongolia; Laos; Sri Lanka; Japan; Russia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

388 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


324 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

153 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99480

Ingredient ID: NPC99244

Ingredient ID: NPC98355

Ingredient ID: NPC98246

Ingredient ID: NPC9822

Ingredient ID: NPC98163

Ingredient ID: NPC95675

Ingredient ID: NPC95090

Ingredient ID: NPC94721

Ingredient ID: NPC92197

Ingredient ID: NPC91734

Ingredient ID: NPC91329

Ingredient ID: NPC88566

Ingredient ID: NPC87517

Ingredient ID: NPC86545

Ingredient ID: NPC85473

Ingredient ID: NPC84824

Ingredient ID: NPC84547

Ingredient ID: NPC84197

Ingredient ID: NPC84030

Ingredient ID: NPC83187

Ingredient ID: NPC82460

Ingredient ID: NPC81102

Ingredient ID: NPC80170

Ingredient ID: NPC79056

Ingredient ID: NPC78872

Ingredient ID: NPC78551

Ingredient ID: NPC78500

Ingredient ID: NPC77773

Ingredient ID: NPC76336

Ingredient ID: NPC76145

Ingredient ID: NPC75204

Ingredient ID: NPC7491

Ingredient ID: NPC74719

Ingredient ID: NPC7314

Ingredient ID: NPC72695

Ingredient ID: NPC71853

Ingredient ID: NPC71703

Ingredient ID: NPC71334

Ingredient ID: NPC71092

Ingredient ID: NPC70622

Ingredient ID: NPC70206

Ingredient ID: NPC69930

Ingredient ID: NPC69629

Ingredient ID: NPC69413

Ingredient ID: NPC69394

Ingredient ID: NPC69348

Ingredient ID: NPC68889

Ingredient ID: NPC67761

Ingredient ID: NPC67508

Ingredient ID: NPC66681

Ingredient ID: NPC66577

Ingredient ID: NPC66124

Ingredient ID: NPC64866

Ingredient ID: NPC64850

Ingredient ID: NPC64176

Ingredient ID: NPC63963

Ingredient ID: NPC63126

Ingredient ID: NPC63121

Ingredient ID: NPC62765

Ingredient ID: NPC62755

Ingredient ID: NPC62486

Ingredient ID: NPC62032

Ingredient ID: NPC6184

Ingredient ID: NPC61828

Ingredient ID: NPC61221

Ingredient ID: NPC61

Ingredient ID: NPC60556

Ingredient ID: NPC60288

Ingredient ID: NPC59581

Ingredient ID: NPC59570

Ingredient ID: NPC58970

Ingredient ID: NPC57877

Ingredient ID: NPC57535

Ingredient ID: NPC57334

Ingredient ID: NPC57234

Ingredient ID: NPC57181

Ingredient ID: NPC56505

Ingredient ID: NPC54430

Ingredient ID: NPC53720

Ingredient ID: NPC53701

Ingredient ID: NPC53195

Ingredient ID: NPC52230

Ingredient ID: NPC52005

Ingredient ID: NPC52001

Ingredient ID: NPC51883

Ingredient ID: NPC51758

Ingredient ID: NPC51700

Ingredient ID: NPC50898

Ingredient ID: NPC49151

Ingredient ID: NPC47489

Ingredient ID: NPC46705

Ingredient ID: NPC46587

Ingredient ID: NPC45592

Ingredient ID: NPC45270

Ingredient ID: NPC44935

Ingredient ID: NPC44931

Ingredient ID: NPC44671

Ingredient ID: NPC44328

Ingredient ID: NPC44272

Ingredient ID: NPC43822

Ingredient ID: NPC43776

Ingredient ID: NPC43493

Ingredient ID: NPC43114

Ingredient ID: NPC41494

Ingredient ID: NPC41373

Ingredient ID: NPC41180

Ingredient ID: NPC41160

Ingredient ID: NPC4079

Ingredient ID: NPC40457

Ingredient ID: NPC39360

Ingredient ID: NPC3911

Ingredient ID: NPC37819

Ingredient ID: NPC37644

Ingredient ID: NPC3649

Ingredient ID: NPC34764

Ingredient ID: NPC315806

Ingredient ID: NPC312929

Ingredient ID: NPC312292

Ingredient ID: NPC311866

Ingredient ID: NPC311632

Ingredient ID: NPC310820

Ingredient ID: NPC310604

Ingredient ID: NPC310478

Ingredient ID: NPC309182

Ingredient ID: NPC30853

Ingredient ID: NPC308453

Ingredient ID: NPC307011

Ingredient ID: NPC307006

Ingredient ID: NPC305531

Ingredient ID: NPC303979

Ingredient ID: NPC302950

Ingredient ID: NPC301195

Ingredient ID: NPC300765

Ingredient ID: NPC299001

Ingredient ID: NPC298218

Ingredient ID: NPC298023

Ingredient ID: NPC297844

Ingredient ID: NPC297527

Ingredient ID: NPC297418

Ingredient ID: NPC296337

Ingredient ID: NPC295777

Ingredient ID: NPC295631

Ingredient ID: NPC295442

Ingredient ID: NPC294902

Ingredient ID: NPC29465

Ingredient ID: NPC291888

Ingredient ID: NPC291724

Ingredient ID: NPC290905

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC289388

Ingredient ID: NPC289366

Ingredient ID: NPC28916

Ingredient ID: NPC288932

Ingredient ID: NPC288726

Ingredient ID: NPC288714

Ingredient ID: NPC288537

Ingredient ID: NPC287550

Ingredient ID: NPC287446

Ingredient ID: NPC287331

Ingredient ID: NPC286774

Ingredient ID: NPC286627

Ingredient ID: NPC286590

Ingredient ID: NPC285814

Ingredient ID: NPC284451

Ingredient ID: NPC284237

Ingredient ID: NPC284027

Ingredient ID: NPC283703

Ingredient ID: NPC283178

Ingredient ID: NPC282923

Ingredient ID: NPC282482

Ingredient ID: NPC278231

Ingredient ID: NPC277569

Ingredient ID: NPC276839

Ingredient ID: NPC274403

Ingredient ID: NPC274261

Ingredient ID: NPC27321

Ingredient ID: NPC272614

Ingredient ID: NPC27184

Ingredient ID: NPC271321

Ingredient ID: NPC26906

Ingredient ID: NPC268862

Ingredient ID: NPC268564

Ingredient ID: NPC268467

Ingredient ID: NPC267021

Ingredient ID: NPC266603

Ingredient ID: NPC265705

Ingredient ID: NPC264779

Ingredient ID: NPC264711

Ingredient ID: NPC264470

Ingredient ID: NPC259512

Ingredient ID: NPC258661

Ingredient ID: NPC257124

Ingredient ID: NPC25636

Ingredient ID: NPC255662

Ingredient ID: NPC255373

Ingredient ID: NPC254847

Ingredient ID: NPC254156

Ingredient ID: NPC25407

Ingredient ID: NPC252230

Ingredient ID: NPC248726

Ingredient ID: NPC247897

Ingredient ID: NPC2476

Ingredient ID: NPC246358

Ingredient ID: NPC243728

Ingredient ID: NPC243368

Ingredient ID: NPC243230

Ingredient ID: NPC242711

Ingredient ID: NPC241308

Ingredient ID: NPC236355

Ingredient ID: NPC235625

Ingredient ID: NPC235265

Ingredient ID: NPC234871

Ingredient ID: NPC234846

Ingredient ID: NPC234133

Ingredient ID: NPC233533

Ingredient ID: NPC233209

Ingredient ID: NPC232995

Ingredient ID: NPC232946

Ingredient ID: NPC23256

Ingredient ID: NPC231773

Ingredient ID: NPC231772

Ingredient ID: NPC231738

Ingredient ID: NPC231018

Ingredient ID: NPC23043

Ingredient ID: NPC230301

Ingredient ID: NPC228858

Ingredient ID: NPC228675

Ingredient ID: NPC226760

Ingredient ID: NPC22484

Ingredient ID: NPC223468

Ingredient ID: NPC223374

Ingredient ID: NPC223315

Ingredient ID: NPC223225

Ingredient ID: NPC222001

Ingredient ID: NPC221384

Ingredient ID: NPC221255

Ingredient ID: NPC221164

Ingredient ID: NPC218109

Ingredient ID: NPC217002

Ingredient ID: NPC216630

Ingredient ID: NPC216519

Ingredient ID: NPC216403

Ingredient ID: NPC215632

Ingredient ID: NPC215118

Ingredient ID: NPC214584

Ingredient ID: NPC213749

Ingredient ID: NPC212070

Ingredient ID: NPC211444

Ingredient ID: NPC210831

Ingredient ID: NPC210288

Ingredient ID: NPC210003

Ingredient ID: NPC209296

Ingredient ID: NPC209275

Ingredient ID: NPC208716

Ingredient ID: NPC208151

Ingredient ID: NPC208075

Ingredient ID: NPC206800

Ingredient ID: NPC206480

Ingredient ID: NPC205556

Ingredient ID: NPC204242

Ingredient ID: NPC202600

Ingredient ID: NPC201136

Ingredient ID: NPC199036

Ingredient ID: NPC198658

Ingredient ID: NPC197977

Ingredient ID: NPC197356

Ingredient ID: NPC196442

Ingredient ID: NPC196439

Ingredient ID: NPC195569

Ingredient ID: NPC19319

Ingredient ID: NPC190810

Ingredient ID: NPC190154

Ingredient ID: NPC189331

Ingredient ID: NPC189197

Ingredient ID: NPC189142

Ingredient ID: NPC187796

Ingredient ID: NPC187061

Ingredient ID: NPC186100

Ingredient ID: NPC185839

Ingredient ID: NPC184831

Ingredient ID: NPC184626

Ingredient ID: NPC184593

Ingredient ID: NPC184049

Ingredient ID: NPC180871

Ingredient ID: NPC180840

Ingredient ID: NPC18074

Ingredient ID: NPC179831

Ingredient ID: NPC179024

Ingredient ID: NPC1788

Ingredient ID: NPC176819

Ingredient ID: NPC176775

Ingredient ID: NPC176309

Ingredient ID: NPC175987

Ingredient ID: NPC173760

Ingredient ID: NPC173228

Ingredient ID: NPC16802

Ingredient ID: NPC167932

Ingredient ID: NPC167318

Ingredient ID: NPC167120

Ingredient ID: NPC166641

Ingredient ID: NPC165929

Ingredient ID: NPC1656

Ingredient ID: NPC163984

Ingredient ID: NPC16157

Ingredient ID: NPC160416

Ingredient ID: NPC15912

Ingredient ID: NPC158537

Ingredient ID: NPC158070

Ingredient ID: NPC156155

Ingredient ID: NPC155182

Ingredient ID: NPC154858

Ingredient ID: NPC154792

Ingredient ID: NPC154219

Ingredient ID: NPC153046

Ingredient ID: NPC152438

Ingredient ID: NPC151919

Ingredient ID: NPC14917

Ingredient ID: NPC148182

Ingredient ID: NPC148141

Ingredient ID: NPC147343

Ingredient ID: NPC14576

Ingredient ID: NPC145216

Ingredient ID: NPC145157

Ingredient ID: NPC144557

Ingredient ID: NPC143639

Ingredient ID: NPC142470

Ingredient ID: NPC142415

Ingredient ID: NPC141777

Ingredient ID: NPC13991

Ingredient ID: NPC139557

Ingredient ID: NPC139546

Ingredient ID: NPC138811

Ingredient ID: NPC138586

Ingredient ID: NPC138347

Ingredient ID: NPC138113

Ingredient ID: NPC13789

Ingredient ID: NPC136029

Ingredient ID: NPC135077

Ingredient ID: NPC134142

Ingredient ID: NPC13402

Ingredient ID: NPC133163

Ingredient ID: NPC131769

Ingredient ID: NPC130760

Ingredient ID: NPC129889

Ingredient ID: NPC128863

Ingredient ID: NPC128280

Ingredient ID: NPC127878

Ingredient ID: NPC127129

Ingredient ID: NPC125144

Ingredient ID: NPC125034

Ingredient ID: NPC124969

Ingredient ID: NPC124876

Ingredient ID: NPC124512

Ingredient ID: NPC123993

Ingredient ID: NPC123663

Ingredient ID: NPC122962

Ingredient ID: NPC122666

Ingredient ID: NPC121001

Ingredient ID: NPC11947

Ingredient ID: NPC117193

Ingredient ID: NPC116452

Ingredient ID: NPC114239

Ingredient ID: NPC114203

Ingredient ID: NPC114103

Ingredient ID: NPC11359

Ingredient ID: NPC112734

Ingredient ID: NPC112610

Ingredient ID: NPC111200

Ingredient ID: NPC110253

Ingredient ID: NPC109813

Ingredient ID: NPC108494

Ingredient ID: NPC108431

Ingredient ID: NPC107949

Ingredient ID: NPC10781

Ingredient ID: NPC1075

Ingredient ID: NPC106250

Ingredient ID: NPC106153

Ingredient ID: NPC104631

Ingredient ID: NPC104590

Ingredient ID: NPC104323

Ingredient ID: NPC103213

Ingredient ID: NPC102766

Ingredient ID: NPC101285

Ingredient ID: NPC100879

Ingredient ID: NPC100380

Ingredient ID: NPC100372