CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Mentha Canadensis

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAAAACTGCAAAGCAGATCGTGAACACGTAACTAACGCCACGGAGCACAATGCAGGGGCGACCGTTTGCCATGTCCCGTGTCCTGCCAGCATGTTCCCTCGGGTYATGCCATGCGGGCTAACGAACCCCGGCACAGAATGCATCAAGGAAAACAAAATGAAGCATCYGCCTCGGGCATYGTGTTYGCAGAGAGTTCCATGGGATCGAGAGTCTATCAAATGTTAAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCATGTCACACCCTACCCCACGTGAATCGCCGGGCGGTTGGGGGTGGATACTGGCCTCCCGTGTGCCTCGGCAAGTGGCCGGCCTAAATGGGATCCCTAGACGACTGGCGTCACGACAAGTGGTGGTTGAACATCTTAATCTCCTCATGGTCATGTTGTCATATCGTCCCATACAAGAATCATAAATGACCCAAYGGTGCATGGCGCAAATAGCGTCTCACTTTTGACTGTGACCCCAGTCAGCGGGATTGCCCATTTAGTTTAAGCATATCAT

Click for details-----ITS1

GCGGAGATCATTGTCGAACCTCGCAAAGCAGACTGCGAACACGTAATTAACTCCGCGGGCCACGGCAAGGGGGCGACCCCTTGCCGTGTCCTGTCCCCCGCCGGCGTGTTCCCTCGGGTCACGTCGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACCAAACGAAGCGTCCGCCCCCGGCACCCCGTTCGCGGAGCGTGCCGTGGGACCGGCCGTCTATCAAATGTCAAAA

Click for details-----ITS2

ATCATGTCACACCCTACCCCACGTGAATCGCCGGGCGGTTGGGGGTGGATACTGGCCTCCCGTGTGCCTCGGCAAGTGGCCGGCCTAAATGGGATCCCTAGACGACTGGCGTCACGACAAGTGGTGGTTGAACATCTTAATCTCCTCATGGTCATGTTGTCATATCGTCCCATACAAGAATCATAAATGACCCAAYGGTGCATGGCGCAAATAGCGTCTCACTTTTGACTGTGACCCCAGTCAGCGGGATTGCCCATTTAGTTTAAGCATATCAT

Taxonomic Information

Plant ID: NPO13857
Plant Latin Name: Mentha Canadensis
Taxonomy Genus: Mentha
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 294733
Plant-of-the-World-Online: 450311-1

Used in Medicines

Country/Region:

Russia

Traditional Medicine System:

Geographical Distribution

Canada; Georgia; Myanmar; Mexico; Thailand; Philippines; Indonesia; Cambodia; South Africa; United States; Vietnam; China; Mongolia; Laos; Sri Lanka; Japan; Russia

Geographical Distribution

−

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Therapeutic Target	Enzyme	APEX1	DNA-(apurinic or apyrimidinic site) lyase	P27695	CHEMBL5619
Therapeutic Target	Enzyme	POLB	DNA polymerase beta	P06746	CHEMBL2392
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Enzyme	RECQL	ATP-dependent DNA helicase Q1	P46063	CHEMBL1293236
Therapeutic Target	Fatty acid binding protein family	FABP4	Fatty acid binding protein adipocyte	P15090	CHEMBL2083
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00299559	Kinetics of Etheric Oils, Smart Textiles vs. Ointment	common cold	Menthol (NPC223468)	NP level
NCT00330096	Effects of Hesperidin on Bone Mineral Density and Bone Metabolism of Postmenopausal Women	osteoporosis	Hesperidin (NPC79056)	NP level
NCT00655733	Phase II Study of HMPL-004 in Subjects With Crohn's Disease	Crohn's disease	Andrographolide (NPC124512)	NP level
NCT00659802	Phase II Study of HMPL-004 in Patients With Ulcerative Colitis	ulcerative colitis	Andrographolide (NPC124512)	NP level
NCT00885599	Efficacy of a Naturally-derived Mouthrinse for Gingival Inflammation	gingivitis	Thymol (NPC259512)	NP level
NCT01110512	Comparative Efficacy of Two Preparations of the Association Diosmin (450 mg) + Hesperidin (50 mg) in the Treatment of Chronic Venous Insufficiency (CVI)	venous insufficiency	Diosmin (NPC209296)	NP level
NCT01119534	Comparative Efficacy of the Suppository Versus Guaiacol Suppository Versus Guaifenesin Syrup in Pediatric Patients With Cough Due the Infectious Origin	Cough	Menthol (NPC223468)	NP level
NCT01119534	Comparative Efficacy of the Suppository Versus Guaiacol Suppository Versus Guaifenesin Syrup in Pediatric Patients With Cough Due the Infectious Origin	Cough	Eucalyptol (NPC287331)	NP level
NCT01233492	Boron Phenylalanine With or Without Mannitol in Treating Patients With Glioblastoma Multiforme	Central Nervous System Neoplasm	L-Phenylalanine (NPC10781)	NP level
NCT01408446	Effects and Safety of Menthol on Blood Pressure and Metabolic Parameters in Prehypertensive and Mild Hypertensive Patients	hypertension	Menthol (NPC223468)	NP level

Associated Disease of the Plant	Association Type & Detailed Evidence
Acne vulgaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED80	ESR1,MMP2
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	MAOB,MAOA
Acquired prion disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E01	ESR1
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	PTPN1,DPP4
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	NFKB1,RELA,CDK8,PTPRC,TP53
Acute respiratory distress syndrome Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB00	F3
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	NFKB1,RELA
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	ACHE,MMP9,CA7,THPO,CA12,TSHR,XDH,CA9,MMP1,AKR1B10,F2,TTR
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CDC25B,CA7,NAPRT,DPP4,CNR2,RECQL,CYP2C19,OR51E2,MMP2,MAOB,PTPN1,HIF1A,ACHE,TTR,LMNA,CES1,POLB,CYP1B1,MMP1,AKR1B10,PTPRC,XDH,CA9,SNCA,F2
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	FABP5,OR51E2,TTR

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Mentha Canadensis

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

388 All known Ingredients in Total

324 Ingredients with Acceptable Bioavailablity

153 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Acne vulgaris

Acquired hypomelanotic disorder

Acquired prion disease

Acute diabete complication

Acute myeloid leukaemia

Acute respiratory distress syndrome

Acute/subacute hepatic failure

Adenocarcinoma of bronchus or lung

Adenocarcinoma of pancreas

Adenocarcinoma of prostate

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities