• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Hyptis Tomentosa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCAAAGCAGACCGCGAACACGTGTTTAACGCATCTCCCCGCCGGCGCGCCACGCGTGCGTCGTGCGGGCTAACGAACCCCGGCGCGGCATGCGCCAAGGAAAACCGAACTCGGCATCGTCCTCCTCCGCATCCCGTCCGCGGGCAGTGCGGGGGCGGTCGGCGTCTATCGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCACCCCGCGCTCCGCGTGGGACGGGGGCGGATATTGGCCTCCCGTGCGTCCCGGCGCGCGGTTGGCCTAAATGCGATCCCCCATGCGGCCCGAGTCGCGACAAGTGGTGGTTGAACTCCTCAATCTCTCGTCTCGTCGTGCATCCGGGCCGTTCGTGTGGGCATCGAGAAAAGACCCTACGGTGCGGTGGCCTCGCCGCCGCGCTCTCGA

Click for details-----ITS1

TCGAAACCTGCAAAGCAGACCGCGAACACGTGTTTAACGCATCTCCCCGCCGGCGCGCCACGCGTGCGTCGTGCGGGCTAACGAACCCCGGCGCGGCATGCGCCAAGGAAAACCGAACTCGGCATCGTCCTCCTCCGCATCCCGTCCGCGGGCAGTGCGGGGGCGGTCGGCGTCTATCGAATGTCAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCTCCACCCCGCGCTCCGCGTGGGACGGGGGCGGATATTGGCCTCCCGTGCGTCCCGGCGCGCGGTTGGCCTAAATGCGATCCCCCATGCGGCCCGAGTCGCGACAAGTGGTGGTTGAACTCCTCAATCTCTCGTCTCGTCGTGCATCCGGGCCGTTCGTGTGGGCATCGAGAAAAGACCCTACGGTGCGGTGGCCTCGCCGCCGCGCTCTCGA
Taxonomic Information

Plant ID: NPO1382
Plant Latin Name: Hyptis Tomentosa
Taxonomy Genus: Hyptis
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 1140079
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

106 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


103 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

41 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99638

Ingredient ID: NPC91702

Ingredient ID: NPC90083

Ingredient ID: NPC85045

Ingredient ID: NPC81781

Ingredient ID: NPC80241

Ingredient ID: NPC71553

Ingredient ID: NPC67012

Ingredient ID: NPC66819

Ingredient ID: NPC66436

Ingredient ID: NPC66292

Ingredient ID: NPC63238

Ingredient ID: NPC57119

Ingredient ID: NPC55349

Ingredient ID: NPC50408

Ingredient ID: NPC49603

Ingredient ID: NPC35437

Ingredient ID: NPC33675

Ingredient ID: NPC325839

Ingredient ID: NPC31279

Ingredient ID: NPC312713

Ingredient ID: NPC310905

Ingredient ID: NPC310208

Ingredient ID: NPC309053

Ingredient ID: NPC30668

Ingredient ID: NPC301585

Ingredient ID: NPC301043

Ingredient ID: NPC296301

Ingredient ID: NPC295998

Ingredient ID: NPC29008

Ingredient ID: NPC287926

Ingredient ID: NPC287660

Ingredient ID: NPC28681

Ingredient ID: NPC284135

Ingredient ID: NPC282703

Ingredient ID: NPC277700

Ingredient ID: NPC275152

Ingredient ID: NPC274356

Ingredient ID: NPC270989

Ingredient ID: NPC268377

Ingredient ID: NPC261661

Ingredient ID: NPC257872

Ingredient ID: NPC252552

Ingredient ID: NPC251040

Ingredient ID: NPC249965

Ingredient ID: NPC24815

Ingredient ID: NPC247871

Ingredient ID: NPC245076

Ingredient ID: NPC244441

Ingredient ID: NPC243749

Ingredient ID: NPC243259

Ingredient ID: NPC240308

Ingredient ID: NPC238737

Ingredient ID: NPC237254

Ingredient ID: NPC232316

Ingredient ID: NPC230828

Ingredient ID: NPC229383

Ingredient ID: NPC227217

Ingredient ID: NPC227002

Ingredient ID: NPC225840

Ingredient ID: NPC222986

Ingredient ID: NPC219671

Ingredient ID: NPC21867

Ingredient ID: NPC218197

Ingredient ID: NPC215975

Ingredient ID: NPC21563

Ingredient ID: NPC212015

Ingredient ID: NPC210969

Ingredient ID: NPC210674

Ingredient ID: NPC210489

Ingredient ID: NPC20674

Ingredient ID: NPC204120

Ingredient ID: NPC203924

Ingredient ID: NPC20387

Ingredient ID: NPC203831

Ingredient ID: NPC197318

Ingredient ID: NPC194996

Ingredient ID: NPC192961

Ingredient ID: NPC190629

Ingredient ID: NPC187616

Ingredient ID: NPC186556

Ingredient ID: NPC184733

Ingredient ID: NPC183987

Ingredient ID: NPC181869

Ingredient ID: NPC178284

Ingredient ID: NPC174727

Ingredient ID: NPC17240

Ingredient ID: NPC170779

Ingredient ID: NPC16830

Ingredient ID: NPC166348

Ingredient ID: NPC16272

Ingredient ID: NPC161405

Ingredient ID: NPC159805

Ingredient ID: NPC141529

Ingredient ID: NPC135479

Ingredient ID: NPC129570

Ingredient ID: NPC128208

Ingredient ID: NPC127233

Ingredient ID: NPC124042

Ingredient ID: NPC12362

Ingredient ID: NPC119949

Ingredient ID: NPC115663

Ingredient ID: NPC112237

Ingredient ID: NPC106739

Ingredient ID: NPC106221

Ingredient ID: NPC104308