CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Pulsatilla Chinensis

Example Image

PLANiTS DNA barcode

Click for details-----ITS

AAGGATCATTGTCGATGCCTGCTCAGCAGAACGACCCGCGAACAAGTGAAAACACCAACTCACGCCGGGGAACAGGACGCCGGACAGCCTCACCGCTGCCCCCGACCCGCACCCCAGCATAACACAAAAAATCCGGCGCAATTGGCGCCAAGGAATACTTACCGGAAATAACGGGTCGACAAGTCGACGCCGTGGATCCGAATACTCAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAACCTTTCTGGTCGAGGGCACGTCTGCCTGGGCGTCACACACAGCGTCGCCCCCACCAAAGCATTTGGATGGGGGCGGAAATTGGCCCCCCGAGCCCCCTGGGCACGGTCGGCACAAATGTTGGCCCTCGGCGGCGAGCGTCGCGGTCAGCGGTGGTTGTACTCTCATCCTCCAAAGACAAAATGACGCGTCCGCCTCGTCGCCCACTGGGCGAAGATGACCCAAGGAGTCTCCCCAACCGGAGACTTCCACCTGCGACCCCAGGTCAGGCGGGATTACCC

Click for details-----ITS1

GGGCAGGTGAGCTGCTAGCAGACGACCCGCGAACAAGTGAAAACACCAACTCACGCCGGGGAACAGGACGCCGGACAGCCTCACCGCTGCCCCCGACCCGCGCCCCAGCACAACACAAAAAATCCGGCGCAATTGGCGCCAAGGAATACTTACCGGAAATAACGGGTCGACAAGTCGACGCCGTGGATCCGAATACTCAAA

Click for details-----ITS2

ACAGCGTCGCCCCCACCAAAGCATTTGGATGAGGGCGGAAATTGGCCCCCCGAGCCCCCTGGGGCACGGTCGGCACAAATGTTGGCCCTCGGCGGCGAGCGTCGCGGTCAGCGGTGGTTGTACTCTCATCCTCCAAAGACAAAATGACGCGTCCACCTCGTCGCCCGCTGGGCGAAGATGACCCAAGGAGTCTCCCCTACCGGAGACTTCCAC

Taxonomic Information

Plant ID: NPO1373
Plant Latin Name: Pulsatilla Chinensis
Taxonomy Genus: Pulsatilla
Taxonomy Family: Ranunculaceae

Plant External Links:

NCBI TaxonomyDB: 714493
Plant-of-the-World-Online: 20005205-1

Used in Medicines

Country/Region:

China

Traditional Medicine System:

TCM

Medicinal Functions:

Analgesic; Antiinflammatory; Antispasmodic; Cardiotonic; Hypnotic; Sedative

Geographical Distribution

China; Russia; Mongolia; South Africa

Geographical Distribution

−

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

106 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

65 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

52 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC99240

Ingredient ID: NPC96750

Ingredient ID: NPC96625

Ingredient ID: NPC95427

Ingredient ID: NPC92125

Ingredient ID: NPC88955

Ingredient ID: NPC87231

Ingredient ID: NPC75426

Ingredient ID: NPC72452

Ingredient ID: NPC70853

Ingredient ID: NPC65920

Ingredient ID: NPC61546

Ingredient ID: NPC56713

Ingredient ID: NPC54636

Ingredient ID: NPC50052

Ingredient ID: NPC475504

Ingredient ID: NPC475374

Ingredient ID: NPC475287

Ingredient ID: NPC42937

Ingredient ID: NPC40432

Ingredient ID: NPC40118

Ingredient ID: NPC37055

Ingredient ID: NPC35836

Ingredient ID: NPC329559

Ingredient ID: NPC325473

Ingredient ID: NPC323787

Ingredient ID: NPC323742

Ingredient ID: NPC320281

Ingredient ID: NPC318193

Ingredient ID: NPC310259

Ingredient ID: NPC296631

Ingredient ID: NPC296556

Ingredient ID: NPC296206

Ingredient ID: NPC29353

Ingredient ID: NPC292677

Ingredient ID: NPC29210

Ingredient ID: NPC291044

Ingredient ID: NPC286544

Ingredient ID: NPC286218

Ingredient ID: NPC282060

Ingredient ID: NPC28198

Ingredient ID: NPC278556

Ingredient ID: NPC27831

Ingredient ID: NPC276093

Ingredient ID: NPC273417

Ingredient ID: NPC270768

Ingredient ID: NPC270617

Ingredient ID: NPC265041

Ingredient ID: NPC264160

Ingredient ID: NPC264005

Ingredient ID: NPC263670

Ingredient ID: NPC262094

Ingredient ID: NPC257468

Ingredient ID: NPC25407

Ingredient ID: NPC253557

Ingredient ID: NPC253545

Ingredient ID: NPC253422

Ingredient ID: NPC253352

Ingredient ID: NPC251263

Ingredient ID: NPC243083

Ingredient ID: NPC236769

Ingredient ID: NPC231456

Ingredient ID: NPC231410

Ingredient ID: NPC225505

Ingredient ID: NPC225153

Ingredient ID: NPC222342

Ingredient ID: NPC22041

Ingredient ID: NPC220089

Ingredient ID: NPC219542

Ingredient ID: NPC216111

Ingredient ID: NPC215916

Ingredient ID: NPC210809

Ingredient ID: NPC210375

Ingredient ID: NPC205093

Ingredient ID: NPC201655

Ingredient ID: NPC195360

Ingredient ID: NPC192977

Ingredient ID: NPC18711

Ingredient ID: NPC175738

Ingredient ID: NPC174679

Ingredient ID: NPC170011

Ingredient ID: NPC167140

Ingredient ID: NPC155550

Ingredient ID: NPC151442

Ingredient ID: NPC150648

Ingredient ID: NPC142753

Ingredient ID: NPC139044

Ingredient ID: NPC136877

Ingredient ID: NPC135172

Ingredient ID: NPC13377

Ingredient ID: NPC130130

Ingredient ID: NPC129997

Ingredient ID: NPC129786

Ingredient ID: NPC129132

Ingredient ID: NPC127447

Ingredient ID: NPC126534

Ingredient ID: NPC123830

Ingredient ID: NPC120514

Ingredient ID: NPC119725

Ingredient ID: NPC115281

Ingredient ID: NPC115219

Ingredient ID: NPC114610

Ingredient ID: NPC114464

Ingredient ID: NPC106084

Ingredient ID: NPC103904

Ingredient ID: NPC101294

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Show entries

Search:

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 19	CYP19A1	Cytochrome P450 19A1	P11511	CHEMBL1978
Cytochrome P450	Cytochrome P450 family 2	CYP2C19	Cytochrome P450 2C19	P33261	CHEMBL3622
Drug Transporter	ATP-binding cassette	ABCG2	ATP-binding cassette sub-family G member 2	Q9UNQ0	CHEMBL5393
Drug Transporter	SLC superfamily of solute carriers	SLCO1B3	Solute carrier organic anion transporter family member 1B3	Q9NPD5	CHEMBL1743121
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Nuclear hormone receptor subfamily 3	ESR1	Estrogen receptor alpha	P03372	CHEMBL206
Therapeutic Target	Potassium channels	KCNA3	Voltage-gated potassium channel subunit Kv1.3	P22001	CHEMBL4633
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Surface antigen	F3	Coagulation factor III	P13726	CHEMBL4081

Showing 1 to 9 of 9 entries

Previous1Next

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	1

Clinical trial details

Show entries

Search:

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT02059785	Phase ⅡStudy of Pinocembrin Injection to Treat Ischemic Stroke	Ischemic stroke	Pinocembrin (NPC243083)	NP level

Showing 1 to 1 of 1 entries

Previous1Next

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Show entries

Search:

Associated Disease of the Plant	Association Type & Detailed Evidence
Acne vulgaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED80	ESR1
Acquired prion disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E01	ESR1
Acute respiratory distress syndrome Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB00	F3
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	SLCO1B3
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	KCNA3,SLCO1B3,CYP2C19,LMNA,CES1,ABCG2
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	SLCO1B3
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	CYP19A1,SLCO1B3
Adrenal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	ESR1
Arteries/arterioles disorder Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD52	MAPK1
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F3

Showing 1 to 10 of 82 entries

Previous1 2 3 4 5…9Next

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Pulsatilla Chinensis

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

106 All known Ingredients in Total

65 Ingredients with Acceptable Bioavailablity

52 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Acne vulgaris

Acquired prion disease

Acute respiratory distress syndrome

Adenocarcinoma of bronchus or lung

Adenocarcinoma of pancreas

Adenocarcinoma of prostate

Adenocarcinoma of stomach

Adrenal cancer

Arteries/arterioles disorder

Bleeding disorder

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities