• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Pulsatilla Chinensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AAGGATCATTGTCGATGCCTGCTCAGCAGAACGACCCGCGAACAAGTGAAAACACCAACTCACGCCGGGGAACAGGACGCCGGACAGCCTCACCGCTGCCCCCGACCCGCACCCCAGCATAACACAAAAAATCCGGCGCAATTGGCGCCAAGGAATACTTACCGGAAATAACGGGTCGACAAGTCGACGCCGTGGATCCGAATACTCAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAACCTTTCTGGTCGAGGGCACGTCTGCCTGGGCGTCACACACAGCGTCGCCCCCACCAAAGCATTTGGATGGGGGCGGAAATTGGCCCCCCGAGCCCCCTGGGCACGGTCGGCACAAATGTTGGCCCTCGGCGGCGAGCGTCGCGGTCAGCGGTGGTTGTACTCTCATCCTCCAAAGACAAAATGACGCGTCCGCCTCGTCGCCCACTGGGCGAAGATGACCCAAGGAGTCTCCCCAACCGGAGACTTCCACCTGCGACCCCAGGTCAGGCGGGATTACCC

Click for details-----ITS1

GGGCAGGTGAGCTGCTAGCAGACGACCCGCGAACAAGTGAAAACACCAACTCACGCCGGGGAACAGGACGCCGGACAGCCTCACCGCTGCCCCCGACCCGCGCCCCAGCACAACACAAAAAATCCGGCGCAATTGGCGCCAAGGAATACTTACCGGAAATAACGGGTCGACAAGTCGACGCCGTGGATCCGAATACTCAAA

Click for details-----ITS2

ACAGCGTCGCCCCCACCAAAGCATTTGGATGAGGGCGGAAATTGGCCCCCCGAGCCCCCTGGGGCACGGTCGGCACAAATGTTGGCCCTCGGCGGCGAGCGTCGCGGTCAGCGGTGGTTGTACTCTCATCCTCCAAAGACAAAATGACGCGTCCACCTCGTCGCCCGCTGGGCGAAGATGACCCAAGGAGTCTCCCCTACCGGAGACTTCCAC
Taxonomic Information

Plant ID: NPO1373
Plant Latin Name: Pulsatilla Chinensis
Taxonomy Genus: Pulsatilla
Taxonomy Family: Ranunculaceae

Plant External Links:

NCBI TaxonomyDB: 714493
Plant-of-the-World-Online: 20005205-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Analgesic; Antiinflammatory; Antispasmodic; Cardiotonic; Hypnotic; Sedative

Geographical Distribution

China; Russia; Mongolia; South Africa

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

106 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


65 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

52 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99240

Ingredient ID: NPC96750

Ingredient ID: NPC96625

Ingredient ID: NPC95427

Ingredient ID: NPC92125

Ingredient ID: NPC88955

Ingredient ID: NPC87231

Ingredient ID: NPC75426

Ingredient ID: NPC72452

Ingredient ID: NPC70853

Ingredient ID: NPC65920

Ingredient ID: NPC61546

Ingredient ID: NPC56713

Ingredient ID: NPC54636

Ingredient ID: NPC50052

Ingredient ID: NPC475504

Ingredient ID: NPC475374

Ingredient ID: NPC475287

Ingredient ID: NPC42937

Ingredient ID: NPC40432

Ingredient ID: NPC40118

Ingredient ID: NPC37055

Ingredient ID: NPC35836

Ingredient ID: NPC329559

Ingredient ID: NPC325473

Ingredient ID: NPC323787

Ingredient ID: NPC323742

Ingredient ID: NPC320281

Ingredient ID: NPC318193

Ingredient ID: NPC310259

Ingredient ID: NPC296631

Ingredient ID: NPC296556

Ingredient ID: NPC296206

Ingredient ID: NPC29353

Ingredient ID: NPC292677

Ingredient ID: NPC29210

Ingredient ID: NPC291044

Ingredient ID: NPC286544

Ingredient ID: NPC286218

Ingredient ID: NPC282060

Ingredient ID: NPC28198

Ingredient ID: NPC278556

Ingredient ID: NPC27831

Ingredient ID: NPC276093

Ingredient ID: NPC273417

Ingredient ID: NPC270768

Ingredient ID: NPC270617

Ingredient ID: NPC265041

Ingredient ID: NPC264160

Ingredient ID: NPC264005

Ingredient ID: NPC263670

Ingredient ID: NPC262094

Ingredient ID: NPC257468

Ingredient ID: NPC25407

Ingredient ID: NPC253557

Ingredient ID: NPC253545

Ingredient ID: NPC253422

Ingredient ID: NPC253352

Ingredient ID: NPC251263

Ingredient ID: NPC243083

Ingredient ID: NPC236769

Ingredient ID: NPC231456

Ingredient ID: NPC231410

Ingredient ID: NPC225505

Ingredient ID: NPC225153

Ingredient ID: NPC222342

Ingredient ID: NPC22041

Ingredient ID: NPC220089

Ingredient ID: NPC219542

Ingredient ID: NPC216111

Ingredient ID: NPC215916

Ingredient ID: NPC210809

Ingredient ID: NPC210375

Ingredient ID: NPC205093

Ingredient ID: NPC201655

Ingredient ID: NPC195360

Ingredient ID: NPC192977

Ingredient ID: NPC18711

Ingredient ID: NPC175738

Ingredient ID: NPC174679

Ingredient ID: NPC170011

Ingredient ID: NPC167140

Ingredient ID: NPC155550

Ingredient ID: NPC151442

Ingredient ID: NPC150648

Ingredient ID: NPC142753

Ingredient ID: NPC139044

Ingredient ID: NPC136877

Ingredient ID: NPC135172

Ingredient ID: NPC13377

Ingredient ID: NPC130130

Ingredient ID: NPC129997

Ingredient ID: NPC129786

Ingredient ID: NPC129132

Ingredient ID: NPC127447

Ingredient ID: NPC126534

Ingredient ID: NPC123830

Ingredient ID: NPC120514

Ingredient ID: NPC119725

Ingredient ID: NPC115281

Ingredient ID: NPC115219

Ingredient ID: NPC114610

Ingredient ID: NPC114464

Ingredient ID: NPC106084

Ingredient ID: NPC103904

Ingredient ID: NPC101294