• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Barleria Acanthoides


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCSCCCCCCGCCCCCGCGGGGAGTGCGGAGACTGGCCTCCCGTGCGCCCCGGCGCGCGGCCGGCCCAAATGCAATCCCCCGGCGGCGTCCGTCGCGACCAGTGGTGGTTGAGCACTCGACCCTCGCGCTGTCCGTCGCGCTCCGCGGCGCCGCCCGGCCGGGCATCACGAACGACCCGCGCCGGGCGCATCCAA
Taxonomic Information

Plant ID: NPO13706
Plant Latin Name: Barleria Acanthoides
Taxonomy Genus: Barleria
Taxonomy Family: Acanthaceae

Plant External Links:

NCBI TaxonomyDB: 1465647
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Kenya; Tanzania; Rwanda; India

Traditional Medicine System:
Ayurveda

Geographical Distribution

Kenya; Tanzania; Rwanda; India

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

16 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


12 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC81455

Ingredient ID: NPC50898

Ingredient ID: NPC43211

Ingredient ID: NPC33067

Ingredient ID: NPC261693

Ingredient ID: NPC261241

Ingredient ID: NPC242839

Ingredient ID: NPC241498

Ingredient ID: NPC234957

Ingredient ID: NPC224145

Ingredient ID: NPC156222

Ingredient ID: NPC142415

Ingredient ID: NPC130342

Ingredient ID: NPC120840

Ingredient ID: NPC102304

Ingredient ID: NPC100887