• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Armoracia Rusticana


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGTCCAAAACAGAATGACCCGCGAACCAAAGATCATCACCCACKGTGGGCCGGTTTCTTAGCCGAGATCGTGCCTGCCAAATCCGTGGTTTCGCGAACAATCCTTACTAGGAGCTATCTCTGTTTGGGTTGTGCGCGTTGCTTCCGGGTATCACAAAACCCCGGCACGAAAAGTGTCAAGGAACATGCAAACGAACAGCCAGCCTTCGCCTCCCCGGAGACGGTGTGTGCGCGGATGCTGTGCTTATCTAAAGTCTAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGTGTCACAAATCGTCGTCCCTCTCATCCTTCTTGGATTTGGGACGGAAGCTGGTCTCCCGTGTGTTACCGCACGCGGTTGGCCAAAATCCGAGCTAAGGACGCCGAGAGCGTCATGACATGCGGTGGTGAACTAAAGCCTCTTCGTATCGTCGGTCGTTCTTGTCCGGAAGCTCTCGATGACCCAAAGTCCTCA

Click for details-----ITS1

TCGAATCCTGTCCAAAACAGAATGACCCGCGAACCAAAGATCATCACCCACKGTGGGCCGGTTTCTTAGCCGAGATCGTGCCTGCCAAATCCGTGGTTTCGCGAACAATCCTTACTAGGAGCTATCTCTGTTTGGGTTGTGCGCGTTGCTTCCGGGTATCACAAAACCCCGGCACGAAAAGTGTCAAGGAACATGCAAACGAACAGCCAGCCTTCGCCTCCCCGGAGACGGTGTGTGCGCGGATGCTGTGCTTATCTAAAGTCTAAAA

Click for details-----ITS2

ATCGTCGTCCCTCTCATCCTTCTTGGATTTGGGACGGAAGCTGGTCTCCCGTGTGTTACCGCACGCGGTTGGCCAAAATCCGAGCTAAGGACGCCGAGAGCGTCATGACATGCGGTGGTGAACTAAAGCCTCTTCGTATCGTCGGTCGTTCTTGTCTGGAAGCTCTCGATGACCCAAAGTCCTCA
Taxonomic Information

Plant ID: NPO13645
Plant Latin Name: Armoracia Rusticana
Taxonomy Genus: Armoracia
Taxonomy Family: Brassicaceae

Plant External Links:

NCBI TaxonomyDB: 3704
Plant-of-the-World-Online: 278747-1

Used in Medicines

Country/Region:
Canada; Italy; Bulgaria

Traditional Medicine System:


Medicinal Functions:

Antibacterial; Antirheumatic; Antiseptic; Aperient; Digestive; Diuretic; Expectorant; Rubefacient; Stimulant

Geographical Distribution

Canada; Turkey; Italy; France; Ireland; Norway; Belarus; China; Belgium; Germany; Spain; Ukraine; Netherlands; Denmark; Poland; Finland; United States; Sweden; Japan; Switzerland; New Zealand; Russia; Bulgaria; Jamaica; Romania; Albania; South Africa; United Kingdom; Austria; Hungary

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

110 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


80 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

76 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC96218

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC90566

Ingredient ID: NPC89422

Ingredient ID: NPC88759

Ingredient ID: NPC88724

Ingredient ID: NPC85813

Ingredient ID: NPC85488

Ingredient ID: NPC78822

Ingredient ID: NPC64370

Ingredient ID: NPC62045

Ingredient ID: NPC60151

Ingredient ID: NPC58312

Ingredient ID: NPC55412

Ingredient ID: NPC49168

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC4812

Ingredient ID: NPC478589

Ingredient ID: NPC478588

Ingredient ID: NPC478587

Ingredient ID: NPC478586

Ingredient ID: NPC478585

Ingredient ID: NPC478584

Ingredient ID: NPC478583

Ingredient ID: NPC478582

Ingredient ID: NPC478581

Ingredient ID: NPC478580

Ingredient ID: NPC478579

Ingredient ID: NPC46747

Ingredient ID: NPC424

Ingredient ID: NPC40791

Ingredient ID: NPC38059

Ingredient ID: NPC328447

Ingredient ID: NPC32118

Ingredient ID: NPC317774

Ingredient ID: NPC317120

Ingredient ID: NPC316726

Ingredient ID: NPC316725

Ingredient ID: NPC313955

Ingredient ID: NPC312800

Ingredient ID: NPC311317

Ingredient ID: NPC308749

Ingredient ID: NPC299472

Ingredient ID: NPC29883

Ingredient ID: NPC295644

Ingredient ID: NPC294548

Ingredient ID: NPC293957

Ingredient ID: NPC290319

Ingredient ID: NPC283389

Ingredient ID: NPC281686

Ingredient ID: NPC279121

Ingredient ID: NPC278683

Ingredient ID: NPC273385

Ingredient ID: NPC272614

Ingredient ID: NPC269919

Ingredient ID: NPC263656

Ingredient ID: NPC26032

Ingredient ID: NPC255607

Ingredient ID: NPC255157

Ingredient ID: NPC254509

Ingredient ID: NPC252493

Ingredient ID: NPC245814

Ingredient ID: NPC242580

Ingredient ID: NPC239406

Ingredient ID: NPC237812

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC223455

Ingredient ID: NPC219143

Ingredient ID: NPC216630

Ingredient ID: NPC213876

Ingredient ID: NPC209970

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC205552

Ingredient ID: NPC203468

Ingredient ID: NPC201844

Ingredient ID: NPC189436

Ingredient ID: NPC187770

Ingredient ID: NPC186902

Ingredient ID: NPC185755

Ingredient ID: NPC17810

Ingredient ID: NPC174246

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC164778

Ingredient ID: NPC154477

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC149617

Ingredient ID: NPC149602

Ingredient ID: NPC148049

Ingredient ID: NPC147983

Ingredient ID: NPC144939

Ingredient ID: NPC143914

Ingredient ID: NPC137958

Ingredient ID: NPC136014

Ingredient ID: NPC131321

Ingredient ID: NPC130683

Ingredient ID: NPC129165

Ingredient ID: NPC127122

Ingredient ID: NPC126681

Ingredient ID: NPC116775

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC111888

Ingredient ID: NPC102128